EMAIL THIS PAGE TO A FRIEND

KLRG1

killer cell lectin-like receptor subfamily G, member 1

107 Gene Product Result for
Synonyms: 2F1 CLEC15A MAFA MAFA-2F1 MAFA-L MAFA-LIKE
UniProtKB ID: Q96E93, B7ZAM2, O43198, O75613
Gene ID:
Human(10219) Summary: Natural killer (NK) cells are lymphocytes that can mediate lysis of certain tumor cells and virus-infected cells without previous activation. They can also regulate specific humoral and cell-mediated immunity. The protein encoded by this gene belongs to the killer cell lectin-like receptor (KLR) family, which is a group of transmembrane proteins preferentially expressed in NK cells. Studies in mice suggested that the expression of this gene may be regulated by MHC class I molecules. Alternatively spliced transcript variants have been reported, but their full-length natures have not yet been determined. [provided by RefSeq, Jul 2008]
Mouse(50928) killer cell lectin-like receptor subfamily G, member 1
Rat(58975) killer cell lectin-like receptor subfamily G, member 1
domestic guinea pig(100729083) killer cell lectin-like receptor subfamily G, member 1
naked mole-rat(101722776) killer cell lectin-like receptor subfamily G, member 1
dog(611464) killer cell lectin-like receptor subfamily G, member 1
cow(100295672) killer cell lectin-like receptor subfamily G, member 1
domestic cat(101098640) killer cell lectin-like receptor subfamily G, member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016970 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016970 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016970 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005810 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005810 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005810 MISSION® shRNA Lentiviral Transduction Particles human pricing

Related Products

Product # Description Species Add to Cart
 
MABF465 Anti-KLRG1 Antibody (mouse), APC, clone 2F1 This golden syrian hamster monoclonal antibody Anti-KLRG1 (mouse), APC, clone 2F1 validated for use in IP & Flow Cytometry for the detection of KLRG1. pricing
MABF733 Anti-KLRG1 Antibody (mouse), APC, clone 2F1 This golden syrian hamster monoclonal antibody Anti-KLRG1 (mouse), APC, clone 2F1 validated for use in IP & Flow Cytometry for the detection of KLRG1. pricing
MABF467 Anti-KLRG1 Antibody (mouse), clone 2F1 This Golden Syrian Hamster Monoclonal Antibody Anti-KLRG1 (mouse), clone 2F1, Cat. No. MABF467 is validated for use in Immunoprecipitation, Flow Cytometry for the detection of KLRG1. pricing
MABF468 Anti-KLRG1 Antibody (mouse), FITC, clone 2F1 This golden syrian hamster monoclonal antibody Anti-KLRG1 (mouse), FITC, clone 2F1 validated for use in IP & Flow Cytometry for the detection of KLRG1. pricing
MABF735 Anti-KLRG1 Antibody (mouse), FITC, clone 2F1 This golden syrian hamster monoclonal antibody Anti-KLRG1 (mouse), FITC, clone 2F1 validated for use in IP & Flow Cytometry for the detection of KLRG1. pricing
MABF466 Anti-KLRG1 Antibody (mouse), PE, clone 2F1 This golden syrian hamster monoclonal antibody Anti-KLRG1 (mouse), PE, clone 2F1 validated for use in IP & Flow Cytometry for the detection of KLRG1. pricing
MABF734 Anti-KLRG1 Antibody (mouse), PE, clone 2F1 This golden syrian hamster monoclonal antibody Anti-KLRG1 (mouse), PE, clone 2F1 validated for use in IP & Flow Cytometry for the detection of KLRG1. pricing
MABF144B Anti-KLRG1 (mouse), violetFluor™ 450, clone 2F1 Antibody Anti-KLRG1 (mouse), violetFluor™ 450, clone 2F1 Antibody is an antibody against KLRG1 for use in Flow Cytometry. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005810 Rosetta Predictions human pricing
NM_031649 Rosetta Predictions rat pricing
NM_016970 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005810 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00233706 predicted 600
2 SASI_Hs01_00233707 predicted 674
3 SASI_Hs01_00233708 predicted 725
4 SASI_Hs01_00233709 predicted 246
5 SASI_Hs01_00233710 predicted 470
6 SASI_Hs01_00233711 predicted 303
7 SASI_Hs01_00233712 predicted 250
8 SASI_Hs02_00340336 predicted 827
9 SASI_Hs01_00233713 predicted 543
10 SASI_Hs01_00233714 predicted 665
11 SASI_Hs01_00233715 predicted 679
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031649 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00264966 predicted 311
2 SASI_Rn02_00264967 predicted 248
3 SASI_Rn02_00264968 predicted 275
4 SASI_Rn02_00264969 predicted 245
5 SASI_Rn01_00107046 predicted 249
6 SASI_Rn01_00107047 predicted 296
7 SASI_Rn02_00264970 predicted 276
8 SASI_Rn02_00264971 predicted 241
9 SASI_Rn02_00264972 predicted 237
10 SASI_Rn02_00264973 predicted 236
11 SASI_Rn01_00107041 predicted 891
12 SASI_Rn01_00107042 predicted 591
13 SASI_Rn01_00107043 predicted 208
14 SASI_Rn01_00107044 predicted 812
15 SASI_Rn01_00107045 predicted 808
16 SASI_Rn01_00107048 predicted 996
17 SASI_Rn01_00107049 predicted 784
18 SASI_Rn01_00107050 predicted 902
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016970 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00021864 predicted 469
2 SASI_Mm02_00323820 predicted 900
3 SASI_Mm01_00021865 predicted 539
4 SASI_Mm01_00021866 predicted 954
5 SASI_Mm01_00021868 predicted 690
6 SASI_Mm01_00021869 predicted 771
7 SASI_Mm01_00021870 predicted 661
8 SASI_Mm01_00021871 predicted 667
9 SASI_Mm01_00021872 predicted 549
10 SASI_Mm01_00021873 predicted 798
11 SASI_Mm01_00021867 predicted 325
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016970
KLRG1 MISSION shRNA Bacterial Glycerol Stock
killer cell lectin-like receptor subfamily G, member 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016970.1-506s21c1
Sequence:CCGGTGCGGTGCCATTCACAGAAATCTCGAGATTTCTGTGAATGGCACCGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016970.1-566s21c1
Sequence:CCGGATCTGTAAGAAGGTCCTATACCTCGAGGTATAGGACCTTCTTACAGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417645    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016970.1-814s21c1
Sequence:CCGGGGGCAAATGAAATGGATAAAGCTCGAGCTTTATCCATTTCATTTGCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066153    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016970.1-954s1c1
Sequence:CCGGGCATTCAGTAACACGTTCCATCTCGAGATGGAACGTGTTACTGAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016970.1-537s1c1
Sequence:CCGGCCTCCAGTTGTGAAGTTGCTTCTCGAGAAGCAACTTCACAACTGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016970.1-262s1c1
Sequence:CCGGGAGGAATGGTAGCCACTGTTACTCGAGTAACAGTGGCTACCATTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016970.1-465s1c1
Sequence:CCGGCGCTCAGCTTGAGGATTCTTACTCGAGTAAGAATCCTCAAGCTGAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016970.1-92s1c1
Sequence:CCGGTGGAAGCTCAAAGCTGTCTTACTCGAGTAAGACAGCTTTGAGCTTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016970
KLRG1 MISSION shRNA shRNA Plasmid DNA
killer cell lectin-like receptor subfamily G, member 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016970.1-506s21c1
Sequence:CCGGTGCGGTGCCATTCACAGAAATCTCGAGATTTCTGTGAATGGCACCGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016970.1-566s21c1
Sequence:CCGGATCTGTAAGAAGGTCCTATACCTCGAGGTATAGGACCTTCTTACAGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417645    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016970.1-814s21c1
Sequence:CCGGGGGCAAATGAAATGGATAAAGCTCGAGCTTTATCCATTTCATTTGCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066153    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016970.1-954s1c1
Sequence:CCGGGCATTCAGTAACACGTTCCATCTCGAGATGGAACGTGTTACTGAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016970.1-537s1c1
Sequence:CCGGCCTCCAGTTGTGAAGTTGCTTCTCGAGAAGCAACTTCACAACTGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016970.1-262s1c1
Sequence:CCGGGAGGAATGGTAGCCACTGTTACTCGAGTAACAGTGGCTACCATTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016970.1-465s1c1
Sequence:CCGGCGCTCAGCTTGAGGATTCTTACTCGAGTAAGAATCCTCAAGCTGAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016970.1-92s1c1
Sequence:CCGGTGGAAGCTCAAAGCTGTCTTACTCGAGTAAGACAGCTTTGAGCTTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016970
KLRG1 MISSION shRNA Lentiviral Transduction Particles
killer cell lectin-like receptor subfamily G, member 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016970.1-506s21c1
Sequence:CCGGTGCGGTGCCATTCACAGAAATCTCGAGATTTCTGTGAATGGCACCGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016970.1-566s21c1
Sequence:CCGGATCTGTAAGAAGGTCCTATACCTCGAGGTATAGGACCTTCTTACAGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417645    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016970.1-814s21c1
Sequence:CCGGGGGCAAATGAAATGGATAAAGCTCGAGCTTTATCCATTTCATTTGCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066153    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016970.1-954s1c1
Sequence:CCGGGCATTCAGTAACACGTTCCATCTCGAGATGGAACGTGTTACTGAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016970.1-537s1c1
Sequence:CCGGCCTCCAGTTGTGAAGTTGCTTCTCGAGAAGCAACTTCACAACTGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016970.1-262s1c1
Sequence:CCGGGAGGAATGGTAGCCACTGTTACTCGAGTAACAGTGGCTACCATTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016970.1-465s1c1
Sequence:CCGGCGCTCAGCTTGAGGATTCTTACTCGAGTAAGAATCCTCAAGCTGAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016970.1-92s1c1
Sequence:CCGGTGGAAGCTCAAAGCTGTCTTACTCGAGTAAGACAGCTTTGAGCTTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005810
KLRG1 MISSION shRNA Bacterial Glycerol Stock
killer cell lectin-like receptor subfamily G, member 1
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000419423    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005810.3-609s21c1
Sequence:CCGGGATCTGTCATGTATCCCTAAACTCGAGTTTAGGGATACATGACAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005810.3-407s21c1
Sequence:CCGGGATTGGTCTGAGGAACAATTCCTCGAGGAATTGTTCCTCAGACCAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005810.3-242s1c1
Sequence:CCGGCCGCTGGATGAAATATGGTAACTCGAGTTACCATATTTCATCCAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005810.3-558s1c1
Sequence:CCGGGTGTGTAAGAAGGTCAGACTTCTCGAGAAGTCTGACCTTCTTACACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005810
KLRG1 MISSION shRNA shRNA Plasmid DNA
killer cell lectin-like receptor subfamily G, member 1
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000419423    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005810.3-609s21c1
Sequence:CCGGGATCTGTCATGTATCCCTAAACTCGAGTTTAGGGATACATGACAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005810.3-407s21c1
Sequence:CCGGGATTGGTCTGAGGAACAATTCCTCGAGGAATTGTTCCTCAGACCAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005810.3-242s1c1
Sequence:CCGGCCGCTGGATGAAATATGGTAACTCGAGTTACCATATTTCATCCAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005810.3-558s1c1
Sequence:CCGGGTGTGTAAGAAGGTCAGACTTCTCGAGAAGTCTGACCTTCTTACACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005810
KLRG1 MISSION shRNA Lentiviral Transduction Particles
killer cell lectin-like receptor subfamily G, member 1
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000419423    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005810.3-609s21c1
Sequence:CCGGGATCTGTCATGTATCCCTAAACTCGAGTTTAGGGATACATGACAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005810.3-407s21c1
Sequence:CCGGGATTGGTCTGAGGAACAATTCCTCGAGGAATTGTTCCTCAGACCAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005810.3-242s1c1
Sequence:CCGGCCGCTGGATGAAATATGGTAACTCGAGTTACCATATTTCATCCAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005810.3-558s1c1
Sequence:CCGGGTGTGTAAGAAGGTCAGACTTCTCGAGAAGTCTGACCTTCTTACACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)