EMAIL THIS PAGE TO A FRIEND

KLRG2

killer cell lectin-like receptor subfamily G, member 2

48 Gene Product Result for
Synonyms: CLEC15B
UniProtKB ID: A4D1S0, Q2NL79, Q6ZTV6
Gene ID:
Mouse(74253) killer cell lectin-like receptor subfamily G, member 2
Rat(689885) killer cell lectin-like receptor subfamily G, member 2
domestic cat(101090600) killer cell lectin-like receptor subfamily G, member 2
cow(531720) killer cell lectin-like receptor subfamily G, member 2
naked mole-rat(101708662) killer cell lectin-like receptor subfamily G, member 2
sheep(101110585) killer cell lectin-like receptor subfamily G, member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198508 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198508 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198508 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033171 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033171 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033171 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU178571 MISSION® esiRNA esiRNA targeting mouse Klrg2 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198508 Rosetta Predictions human pricing
XM_001072378 Rosetta Predictions rat pricing
NM_001033171 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198508 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00167185 predicted 826
2 SASI_Hs01_00167186 predicted 1189
3 SASI_Hs01_00167187 predicted 1179
4 SASI_Hs01_00167188 predicted 971
5 SASI_Hs01_00167189 predicted 424
6 SASI_Hs01_00167190 predicted 1194
7 SASI_Hs01_00167191 predicted 1076
8 SASI_Hs01_00167192 predicted 972
9 SASI_Hs01_00167193 predicted 436
10 SASI_Hs02_00372078 predicted 1075
11 SASI_Hs01_00167194 predicted 1084
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072378 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00338942 predicted 1006
2 SASI_Rn02_00338943 predicted 1003
3 SASI_Rn02_00338944 predicted 947
4 SASI_Rn02_00338945 predicted 943
5 SASI_Rn02_00338946 predicted 940
6 SASI_Rn02_00338947 predicted 426
7 SASI_Rn02_00338948 predicted 1073
8 SASI_Rn02_00338949 predicted 812
9 SASI_Rn02_00338950 predicted 1094
10 SASI_Rn02_00338951 predicted 902
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033171 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00288266 predicted 1016
2 SASI_Mm02_00288267 predicted 1529
3 SASI_Mm02_00288268 predicted 995
4 SASI_Mm02_00288269 predicted 1762
5 SASI_Mm02_00288270 predicted 1313
6 SASI_Mm02_00288271 predicted 958
7 SASI_Mm02_00288272 predicted 1194
8 SASI_Mm02_00288273 predicted 1649
9 SASI_Mm02_00288274 predicted 1195
10 SASI_Mm02_00288275 predicted 1615
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198508
VALIDATED
KLRG2 MISSION shRNA Bacterial Glycerol Stock
killer cell lectin-like receptor subfamily G, member 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198508.2-186s21c1
Sequence:CCGGACAACCTGAAGGTCCCGAAAGCTCGAGCTTTCGGGACCTTCAGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_198508.2-432s21c1
Sequence:CCGGCATGGAGCTGCAGGTAGATGTCTCGAGACATCTACCTGCAGCTCCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198508.2-1191s21c1
Sequence:CCGGCGGCGAGGACAATCTGGATATCTCGAGATATCCAGATTGTCCTCGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198508.1-1198s1c1
Sequence:CCGGGCGAGGACAATCTGGATATCACTCGAGTGATATCCAGATTGTCCTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198508.1-1203s1c1
Sequence:CCGGGACAATCTGGATATCAACTGTCTCGAGACAGTTGATATCCAGATTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150905    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198508.1-1730s1c1
Sequence:CCGGGATAACGTCATTGCTGTGAATCTCGAGATTCACAGCAATGACGTTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_198508.2-964s21c1
Sequence:CCGGTTGTCCGAGGAGCACTGTTACCTCGAGGTAACAGTGCTCCTCGGACAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_198508.2-827s21c1
Sequence:CCGGGGCTACCCATGTACGTGAAGTCTCGAGACTTCACGTACATGGGTAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198508
VALIDATED
KLRG2 MISSION shRNA shRNA Plasmid DNA
killer cell lectin-like receptor subfamily G, member 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198508.2-186s21c1
Sequence:CCGGACAACCTGAAGGTCCCGAAAGCTCGAGCTTTCGGGACCTTCAGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_198508.2-432s21c1
Sequence:CCGGCATGGAGCTGCAGGTAGATGTCTCGAGACATCTACCTGCAGCTCCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198508.2-1191s21c1
Sequence:CCGGCGGCGAGGACAATCTGGATATCTCGAGATATCCAGATTGTCCTCGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198508.1-1198s1c1
Sequence:CCGGGCGAGGACAATCTGGATATCACTCGAGTGATATCCAGATTGTCCTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198508.1-1203s1c1
Sequence:CCGGGACAATCTGGATATCAACTGTCTCGAGACAGTTGATATCCAGATTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150905    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198508.1-1730s1c1
Sequence:CCGGGATAACGTCATTGCTGTGAATCTCGAGATTCACAGCAATGACGTTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_198508.2-964s21c1
Sequence:CCGGTTGTCCGAGGAGCACTGTTACCTCGAGGTAACAGTGCTCCTCGGACAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_198508.2-827s21c1
Sequence:CCGGGGCTACCCATGTACGTGAAGTCTCGAGACTTCACGTACATGGGTAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198508
VALIDATED
KLRG2 MISSION shRNA Lentiviral Transduction Particles
killer cell lectin-like receptor subfamily G, member 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198508.2-186s21c1
Sequence:CCGGACAACCTGAAGGTCCCGAAAGCTCGAGCTTTCGGGACCTTCAGGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_198508.2-432s21c1
Sequence:CCGGCATGGAGCTGCAGGTAGATGTCTCGAGACATCTACCTGCAGCTCCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198508.2-1191s21c1
Sequence:CCGGCGGCGAGGACAATCTGGATATCTCGAGATATCCAGATTGTCCTCGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198508.1-1198s1c1
Sequence:CCGGGCGAGGACAATCTGGATATCACTCGAGTGATATCCAGATTGTCCTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198508.1-1203s1c1
Sequence:CCGGGACAATCTGGATATCAACTGTCTCGAGACAGTTGATATCCAGATTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150905    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198508.1-1730s1c1
Sequence:CCGGGATAACGTCATTGCTGTGAATCTCGAGATTCACAGCAATGACGTTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_198508.2-964s21c1
Sequence:CCGGTTGTCCGAGGAGCACTGTTACCTCGAGGTAACAGTGCTCCTCGGACAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_198508.2-827s21c1
Sequence:CCGGGGCTACCCATGTACGTGAAGTCTCGAGACTTCACGTACATGGGTAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033171
KLRG2 MISSION shRNA Bacterial Glycerol Stock
killer cell lectin-like receptor subfamily G, member 2
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000178376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033171.1-1006s1c1
Sequence:CCGGGAACAATGCTACTACCTCTCTCTCGAGAGAGAGGTAGTAGCATTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198143    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001033171.1-1648s1c1
Sequence:CCGGCCCAGAGCATTCCTATTACAACTCGAGTTGTAATAGGAATGCTCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033171.1-1309s1c1
Sequence:CCGGGTCTGTGCCAGAGAAACCAAACTCGAGTTTGGTTTCTCTGGCACAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033171.1-999s1c1
Sequence:CCGGGTCTCAGGAACAATGCTACTACTCGAGTAGTAGCATTGTTCCTGAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176468    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001033171.1-1649s1c1
Sequence:CCGGCCAGAGCATTCCTATTACAAACTCGAGTTTGTAATAGGAATGCTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033171.1-1101s1c1
Sequence:CCGGCACCCAGGACTTCTTAAGAAACTCGAGTTTCTTAAGAAGTCCTGGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033171
KLRG2 MISSION shRNA shRNA Plasmid DNA
killer cell lectin-like receptor subfamily G, member 2
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000178376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033171.1-1006s1c1
Sequence:CCGGGAACAATGCTACTACCTCTCTCTCGAGAGAGAGGTAGTAGCATTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198143    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001033171.1-1648s1c1
Sequence:CCGGCCCAGAGCATTCCTATTACAACTCGAGTTGTAATAGGAATGCTCTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033171.1-1309s1c1
Sequence:CCGGGTCTGTGCCAGAGAAACCAAACTCGAGTTTGGTTTCTCTGGCACAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033171.1-999s1c1
Sequence:CCGGGTCTCAGGAACAATGCTACTACTCGAGTAGTAGCATTGTTCCTGAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176468    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001033171.1-1649s1c1
Sequence:CCGGCCAGAGCATTCCTATTACAAACTCGAGTTTGTAATAGGAATGCTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033171.1-1101s1c1
Sequence:CCGGCACCCAGGACTTCTTAAGAAACTCGAGTTTCTTAAGAAGTCCTGGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033171
KLRG2 MISSION shRNA Lentiviral Transduction Particles
killer cell lectin-like receptor subfamily G, member 2
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000178376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033171.1-1006s1c1
Sequence:CCGGGAACAATGCTACTACCTCTCTCTCGAGAGAGAGGTAGTAGCATTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198143    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001033171.1-1648s1c1
Sequence:CCGGCCCAGAGCATTCCTATTACAACTCGAGTTGTAATAGGAATGCTCTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033171.1-1309s1c1
Sequence:CCGGGTCTGTGCCAGAGAAACCAAACTCGAGTTTGGTTTCTCTGGCACAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033171.1-999s1c1
Sequence:CCGGGTCTCAGGAACAATGCTACTACTCGAGTAGTAGCATTGTTCCTGAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176468    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001033171.1-1649s1c1
Sequence:CCGGCCAGAGCATTCCTATTACAAACTCGAGTTTGTAATAGGAATGCTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033171.1-1101s1c1
Sequence:CCGGCACCCAGGACTTCTTAAGAAACTCGAGTTTCTTAAGAAGTCCTGGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)