EMAIL THIS PAGE TO A FRIEND

Klri2

22 Gene Product Result for
Gene ID:
Rat(503650) killer cell lectin-like receptor family I member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177155 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177155 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177155 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU093021 MISSION® esiRNA targeting mouse Klri2 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012648 Rosetta Predictions rat pricing
NM_177155 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012648 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00104227 predicted 248
2 SASI_Rn01_00104228 predicted 283
3 SASI_Rn01_00104229 predicted 236
4 SASI_Rn01_00104230 predicted 364
5 SASI_Rn01_00104231 predicted 359
6 SASI_Rn01_00104232 predicted 275
7 SASI_Rn01_00104233 predicted 379
8 SASI_Rn01_00104234 predicted 403
9 SASI_Rn01_00104235 predicted 283
10 SASI_Rn01_00104236 predicted 403
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177155 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00072869 predicted 294
2 SASI_Mm01_00072870 predicted 676
3 SASI_Mm01_00072871 predicted 301
4 SASI_Mm01_00072872 predicted 377
5 SASI_Mm01_00072873 predicted 1203
6 SASI_Mm01_00072874 predicted 677
7 SASI_Mm01_00072876 predicted 271
8 SASI_Mm01_00072877 predicted 684
9 SASI_Mm01_00072878 predicted 381
10 SASI_Mm02_00347152 predicted 281
11 SASI_Mm01_00072875 predicted 259
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177155
Klri2 MISSION shRNA Bacterial Glycerol Stock
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177155.2-678s1c1
Sequence:CCGGCGGAACACCCTAATGAATGATCTCGAGATCATTCATTAGGGTGTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126534    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177155.2-3147s1c1
Sequence:CCGGCCTGGTTTAATGTGTTTGTATCTCGAGATACAAACACATTAAACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177155.2-82s1c1
Sequence:CCGGGAACAAACAAGCAGGAGATTACTCGAGTAATCTCCTGCTTGTTTGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177155.2-343s1c1
Sequence:CCGGGCTTCTTGATTCCAAGCTTATCTCGAGATAAGCTTGGAATCAAGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177155.2-344s1c1
Sequence:CCGGCTTCTTGATTCCAAGCTTATTCTCGAGAATAAGCTTGGAATCAAGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000452375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177155.4-722s21c1
Sequence:CCGGAGAATCATAGCTGCCATTATCCTCGAGGATAATGGCAGCTATGATTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177155
Klri2 MISSION shRNA shRNA Plasmid DNA
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177155.2-678s1c1
Sequence:CCGGCGGAACACCCTAATGAATGATCTCGAGATCATTCATTAGGGTGTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126534    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177155.2-3147s1c1
Sequence:CCGGCCTGGTTTAATGTGTTTGTATCTCGAGATACAAACACATTAAACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177155.2-82s1c1
Sequence:CCGGGAACAAACAAGCAGGAGATTACTCGAGTAATCTCCTGCTTGTTTGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177155.2-343s1c1
Sequence:CCGGGCTTCTTGATTCCAAGCTTATCTCGAGATAAGCTTGGAATCAAGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177155.2-344s1c1
Sequence:CCGGCTTCTTGATTCCAAGCTTATTCTCGAGAATAAGCTTGGAATCAAGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000452375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177155.4-722s21c1
Sequence:CCGGAGAATCATAGCTGCCATTATCCTCGAGGATAATGGCAGCTATGATTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177155
Klri2 MISSION shRNA Lentiviral Transduction Particles
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177155.2-678s1c1
Sequence:CCGGCGGAACACCCTAATGAATGATCTCGAGATCATTCATTAGGGTGTTCCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000126534    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177155.2-3147s1c1
Sequence:CCGGCCTGGTTTAATGTGTTTGTATCTCGAGATACAAACACATTAAACCAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000126537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177155.2-82s1c1
Sequence:CCGGGAACAAACAAGCAGGAGATTACTCGAGTAATCTCCTGCTTGTTTGTTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000126535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177155.2-343s1c1
Sequence:CCGGGCTTCTTGATTCCAAGCTTATCTCGAGATAAGCTTGGAATCAAGAAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000126536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177155.2-344s1c1
Sequence:CCGGCTTCTTGATTCCAAGCTTATTCTCGAGAATAAGCTTGGAATCAAGAAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000452375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177155.4-722s21c1
Sequence:CCGGAGAATCATAGCTGCCATTATCCTCGAGGATAATGGCAGCTATGATTCTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???