EMAIL THIS PAGE TO A FRIEND

KLRK1

killer cell lectin-like receptor subfamily K, member 1

114 Gene Product Result for
Synonyms: CD314 D12S2489E KLR NKG2-D NKG2D
UniProtKB ID: P26718, A8K7K5, A8K7P4, Q9NR41
Gene ID:
Human(22914) Summary: Natural killer (NK) cells are lymphocytes that can mediate lysis of certain tumor cells and virus-infected cells without previous activation. They can also regulate specific humoral and cell-mediated immunity. NK cells preferentially express several calcium-dependent (C-type) lectins, which have been implicated in the regulation of NK cell function. The NKG2 gene family is located within the NK complex, a region that contains several C-type lectin genes preferentially expressed in NK cells. This gene encodes a member of the NKG2 family. The encoded transmembrane protein is characterized by a type II membrane orientation (has an extracellular C terminus) and the presence of a C-type lectin domain. It binds to a diverse family of ligands that include MHC class I chain-related A and B proteins and UL-16 binding proteins, where ligand-receptor interactions can result in the activation of NK and T cells. The surface expression of these ligands is important for the recognition of stressed cells by the immune system, and thus this protein and its ligands are therapeutic targets for the treatment of immune diseases and cancers. Read-through transcription exists between this gene and the upstream KLRC4 (killer cell lectin-like receptor subfamily C, member 4) family member in the same cluster. [provided by RefSeq, Dec 2010]
Mouse(27007) killer cell lectin-like receptor subfamily K, member 1
Rat(24934) killer cell lectin-like receptor subfamily K, member 1
cow(404058) killer cell lectin-like receptor subfamily K, member 1
dog(611355) killer cell lectin-like receptor subfamily K, member 1
domestic cat(101086984) killer cell lectin-like receptor subfamily K, member 1
domestic guinea pig(100723644) killer cell lectin-like receptor subfamily K, member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007360 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007360 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007360 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_033078 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_033078 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_033078 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007360 Rosetta Predictions human pricing
NM_133512 Rosetta Predictions rat pricing
NM_001083322 Rosetta Predictions mouse pricing
NM_033078 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007360 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00243917 predicted 592
2 SASI_Hs01_00243918 predicted 578
3 SASI_Hs01_00243919 predicted 582
4 SASI_Hs01_00243920 predicted 583
5 SASI_Hs01_00243921 predicted 551
6 SASI_Hs01_00243922 predicted 583
7 SASI_Hs01_00243923 predicted 580
8 SASI_Hs01_00243924 predicted 550
9 SASI_Hs01_00243925 predicted 553
10 SASI_Hs01_00243926 predicted 577
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133512 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00267691 predicted 636
2 SASI_Rn01_00098549 predicted 609
3 SASI_Rn02_00267692 predicted 442
4 SASI_Rn01_00098550 predicted 341
5 SASI_Rn01_00098551 predicted 766
6 SASI_Rn01_00098552 predicted 247
7 SASI_Rn01_00098553 predicted 750
8 SASI_Rn01_00098555 predicted 485
9 SASI_Rn01_00098556 predicted 526
10 SASI_Rn01_00098557 predicted 494
11 SASI_Rn01_00098548 predicted 362
12 SASI_Rn01_00098554 predicted 551
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083322 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00299641 predicted 737
2 SASI_Mm02_00299642 predicted 337
3 SASI_Mm02_00299643 predicted 607
4 SASI_Mm02_00299644 predicted 355
5 SASI_Mm02_00299645 predicted 568
6 SASI_Mm02_00299646 predicted 648
7 SASI_Mm02_00299647 predicted 474
8 SASI_Mm02_00299648 predicted 239
9 SASI_Mm02_00299649 predicted 635
10 SASI_Mm02_00299650 predicted 758
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033078 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00167771 predicted 841
2 SASI_Mm01_00167772 predicted 435
3 SASI_Mm01_00167773 predicted 713
4 SASI_Mm01_00167774 predicted 457
5 SASI_Mm02_00337280 predicted 669
6 SASI_Mm01_00167775 predicted 752
7 SASI_Mm01_00167776 predicted 583
8 SASI_Mm01_00167777 predicted 336
9 SASI_Mm01_00167778 predicted 742
10 SASI_Mm02_00337281 predicted 860
11 SASI_Mm01_00167770 predicted 291
12 SASI_Mm01_00167779 predicted 359
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007360
KLRK1 MISSION shRNA Bacterial Glycerol Stock
killer cell lectin-like receptor subfamily K, member 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000421576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007360.2-585s21c1
Sequence:CCGGGAGGACCAGGATTTACTTAAACTCGAGTTTAAGTAAATCCTGGTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007360.1-864s1c1
Sequence:CCGGCCCAACCTACTAACAATAATTCTCGAGAATTATTGTTAGTAGGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007360.1-446s1c1
Sequence:CCGGGCAAAGATGTCCAGTAGTCAACTCGAGTTGACTACTGGACATCTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007360.1-564s1c1
Sequence:CCGGGCTGTATTCCTAAACTCATTACTCGAGTAATGAGTTTAGGAATACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007360.1-916s1c1
Sequence:CCGGCCTCGAGCTTTAAAGGCTATACTCGAGTATAGCCTTTAAAGCTCGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007360.1-807s1c1
Sequence:CCGGCTAGTACACATTCCAACAAATCTCGAGATTTGTTGGAATGTGTACTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007360.2-233s21c1
Sequence:CCGGGGATCTGAAGAAGAGTGATTTCTCGAGAAATCACTCTTCTTCAGATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007360
KLRK1 MISSION shRNA shRNA Plasmid DNA
killer cell lectin-like receptor subfamily K, member 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000421576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007360.2-585s21c1
Sequence:CCGGGAGGACCAGGATTTACTTAAACTCGAGTTTAAGTAAATCCTGGTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007360.1-864s1c1
Sequence:CCGGCCCAACCTACTAACAATAATTCTCGAGAATTATTGTTAGTAGGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007360.1-446s1c1
Sequence:CCGGGCAAAGATGTCCAGTAGTCAACTCGAGTTGACTACTGGACATCTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007360.1-564s1c1
Sequence:CCGGGCTGTATTCCTAAACTCATTACTCGAGTAATGAGTTTAGGAATACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007360.1-916s1c1
Sequence:CCGGCCTCGAGCTTTAAAGGCTATACTCGAGTATAGCCTTTAAAGCTCGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007360.1-807s1c1
Sequence:CCGGCTAGTACACATTCCAACAAATCTCGAGATTTGTTGGAATGTGTACTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007360.2-233s21c1
Sequence:CCGGGGATCTGAAGAAGAGTGATTTCTCGAGAAATCACTCTTCTTCAGATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007360
KLRK1 MISSION shRNA Lentiviral Transduction Particles
killer cell lectin-like receptor subfamily K, member 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000421576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007360.2-585s21c1
Sequence:CCGGGAGGACCAGGATTTACTTAAACTCGAGTTTAAGTAAATCCTGGTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007360.1-864s1c1
Sequence:CCGGCCCAACCTACTAACAATAATTCTCGAGAATTATTGTTAGTAGGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007360.1-446s1c1
Sequence:CCGGGCAAAGATGTCCAGTAGTCAACTCGAGTTGACTACTGGACATCTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007360.1-564s1c1
Sequence:CCGGGCTGTATTCCTAAACTCATTACTCGAGTAATGAGTTTAGGAATACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007360.1-916s1c1
Sequence:CCGGCCTCGAGCTTTAAAGGCTATACTCGAGTATAGCCTTTAAAGCTCGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007360.1-807s1c1
Sequence:CCGGCTAGTACACATTCCAACAAATCTCGAGATTTGTTGGAATGTGTACTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007360.2-233s21c1
Sequence:CCGGGGATCTGAAGAAGAGTGATTTCTCGAGAAATCACTCTTCTTCAGATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033078
KLRK1 MISSION shRNA Bacterial Glycerol Stock
killer cell lectin-like receptor subfamily K, member 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033078.2-271s1c1
Sequence:CCGGCCTTGCTATAGCCTTGGCAATCTCGAGATTGCCAAGGCTATAGCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067133    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033078.2-992s1c1
Sequence:CCGGGCCTATCCAAACTAGGGAAATCTCGAGATTTCCCTAGTTTGGATAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033078.2-508s1c1
Sequence:CCGGCCTTCTGAAGATATACAGTAACTCGAGTTACTGTATATCTTCAGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033078.2-401s1c1
Sequence:CCGGCCATGCCCTAACAACTGGATACTCGAGTATCCAGTTGTTAGGGCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033078.2-677s1c1
Sequence:CCGGGCTGTCTATGGCTCAAGCTTTCTCGAGAAAGCTTGAGCCATAGACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033078
KLRK1 MISSION shRNA shRNA Plasmid DNA
killer cell lectin-like receptor subfamily K, member 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033078.2-271s1c1
Sequence:CCGGCCTTGCTATAGCCTTGGCAATCTCGAGATTGCCAAGGCTATAGCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067133    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033078.2-992s1c1
Sequence:CCGGGCCTATCCAAACTAGGGAAATCTCGAGATTTCCCTAGTTTGGATAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033078.2-508s1c1
Sequence:CCGGCCTTCTGAAGATATACAGTAACTCGAGTTACTGTATATCTTCAGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033078.2-401s1c1
Sequence:CCGGCCATGCCCTAACAACTGGATACTCGAGTATCCAGTTGTTAGGGCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033078.2-677s1c1
Sequence:CCGGGCTGTCTATGGCTCAAGCTTTCTCGAGAAAGCTTGAGCCATAGACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033078
KLRK1 MISSION shRNA Lentiviral Transduction Particles
killer cell lectin-like receptor subfamily K, member 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033078.2-271s1c1
Sequence:CCGGCCTTGCTATAGCCTTGGCAATCTCGAGATTGCCAAGGCTATAGCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067133    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033078.2-992s1c1
Sequence:CCGGGCCTATCCAAACTAGGGAAATCTCGAGATTTCCCTAGTTTGGATAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033078.2-508s1c1
Sequence:CCGGCCTTCTGAAGATATACAGTAACTCGAGTTACTGTATATCTTCAGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033078.2-401s1c1
Sequence:CCGGCCATGCCCTAACAACTGGATACTCGAGTATCCAGTTGTTAGGGCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033078.2-677s1c1
Sequence:CCGGGCTGTCTATGGCTCAAGCTTTCTCGAGAAAGCTTGAGCCATAGACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)