EMAIL THIS PAGE TO A FRIEND

KMO

kynurenine 3-monooxygenase (kynurenine 3-hydroxylase)

109 Gene Product Result for
Synonyms: dJ317G22.1
Gene ID:
Human(8564) Summary: This gene encodes a mitochondrion outer membrane protein that catalyzes the hydroxylation of L-tryptophan metabolite, L-kynurenine, to form L-3-hydroxykynurenine. Studies in yeast identified this gene as a therapeutic target for Huntington disease. [provided by RefSeq, Oct 2011]
Mouse(98256) kynurenine 3-monooxygenase (kynurenine 3-hydroxylase)
Rat(59113) kynurenine 3-monooxygenase (kynurenine 3-hydroxylase)
Zebrafish(368242) kynurenine 3-monooxygenase
cow(515996) kynurenine 3-monooxygenase (kynurenine 3-hydroxylase)
domestic cat(101095789) kynurenine 3-monooxygenase (kynurenine 3-hydroxylase)
dog(480093) kynurenine 3-monooxygenase (kynurenine 3-hydroxylase)
chicken(424041) kynurenine 3-monooxygenase (kynurenine 3-hydroxylase)
sheep(101121026) kynurenine 3-monooxygenase (kynurenine 3-hydroxylase)
Domestic Rabbit(100348763) kynurenine 3-monooxygenase (kynurenine 3-hydroxylase)
domestic guinea pig(100729185) kynurenine 3-monooxygenase (kynurenine 3-hydroxylase)
naked mole-rat(101716403) kynurenine 3-monooxygenase (kynurenine 3-hydroxylase)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133809 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133809 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133809 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003679 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003679 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003679 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003679 Rosetta Predictions human pricing
NM_021593 Rosetta Predictions rat pricing
NM_133809 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003679 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00221008 predicted 1318
2 SASI_Hs01_00221009 predicted 1204
3 SASI_Hs02_00336083 predicted 749
4 SASI_Hs01_00221016 predicted 1385
5 SASI_Hs01_00221010 predicted 863
6 SASI_Hs02_00336084 predicted 602
7 SASI_Hs01_00221011 predicted 682
8 SASI_Hs01_00221012 predicted 1618
9 SASI_Hs01_00221013 predicted 619
10 SASI_Hs01_00221017 predicted 567
11 SASI_Hs01_00221014 predicted 1112
12 SASI_Hs01_00221015 predicted 1210
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021593 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00079414 predicted 719
2 SASI_Rn01_00079415 predicted 663
3 SASI_Rn01_00079416 predicted 1196
4 SASI_Rn01_00079417 predicted 1101
5 SASI_Rn01_00079418 predicted 279
6 SASI_Rn01_00079419 predicted 1031
7 SASI_Rn01_00079420 predicted 625
8 SASI_Rn01_00079421 predicted 792
9 SASI_Rn01_00079422 predicted 1118
10 SASI_Rn01_00079423 predicted 1302
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133809 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00020616 predicted 582
2 SASI_Mm01_00020617 predicted 1099
3 SASI_Mm01_00020618 predicted 1485
4 SASI_Mm01_00020619 predicted 674
5 SASI_Mm01_00020620 predicted 1494
6 SASI_Mm01_00020621 predicted 1087
7 SASI_Mm01_00020622 predicted 1189
8 SASI_Mm01_00020623 predicted 1322
9 SASI_Mm01_00020624 predicted 1285
10 SASI_Mm01_00020625 predicted 699
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133809
KMO MISSION shRNA Bacterial Glycerol Stock
kynurenine 3-monooxygenase (kynurenine 3-hydroxylase)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076458    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133809.1-1801s1c1
Sequence:CCGGGCCTAGTGCTACTTCCTCTTACTCGAGTAAGAGGAAGTAGCACTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133809.1-573s1c1
Sequence:CCGGCTTTGATTACACTCAGCAATACTCGAGTATTGCTGAGTGTAATCAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133809.1-571s1c1
Sequence:CCGGCGCTTTGATTACACTCAGCAACTCGAGTTGCTGAGTGTAATCAAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133809.1-685s1c1
Sequence:CCGGGCCTATATGATGATCGCCCTTCTCGAGAAGGGCGATCATCATATAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133809.1-267s1c1
Sequence:CCGGGCCCATGAAAGCCAGAATGATCTCGAGATCATTCTGGCTTTCATGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133809
KMO MISSION shRNA shRNA Plasmid DNA
kynurenine 3-monooxygenase (kynurenine 3-hydroxylase)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076458    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133809.1-1801s1c1
Sequence:CCGGGCCTAGTGCTACTTCCTCTTACTCGAGTAAGAGGAAGTAGCACTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133809.1-573s1c1
Sequence:CCGGCTTTGATTACACTCAGCAATACTCGAGTATTGCTGAGTGTAATCAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133809.1-571s1c1
Sequence:CCGGCGCTTTGATTACACTCAGCAACTCGAGTTGCTGAGTGTAATCAAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133809.1-685s1c1
Sequence:CCGGGCCTATATGATGATCGCCCTTCTCGAGAAGGGCGATCATCATATAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133809.1-267s1c1
Sequence:CCGGGCCCATGAAAGCCAGAATGATCTCGAGATCATTCTGGCTTTCATGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133809
KMO MISSION shRNA Lentiviral Transduction Particles
kynurenine 3-monooxygenase (kynurenine 3-hydroxylase)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076458    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133809.1-1801s1c1
Sequence:CCGGGCCTAGTGCTACTTCCTCTTACTCGAGTAAGAGGAAGTAGCACTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133809.1-573s1c1
Sequence:CCGGCTTTGATTACACTCAGCAATACTCGAGTATTGCTGAGTGTAATCAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133809.1-571s1c1
Sequence:CCGGCGCTTTGATTACACTCAGCAACTCGAGTTGCTGAGTGTAATCAAAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133809.1-685s1c1
Sequence:CCGGGCCTATATGATGATCGCCCTTCTCGAGAAGGGCGATCATCATATAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133809.1-267s1c1
Sequence:CCGGGCCCATGAAAGCCAGAATGATCTCGAGATCATTCTGGCTTTCATGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003679
KMO MISSION shRNA Bacterial Glycerol Stock
kynurenine 3-monooxygenase (kynurenine 3-hydroxylase)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003679.1-792s1c1
Sequence:CCGGCCAGTAATGATGTGGTAGATTCTCGAGAATCTACCACATCATTACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003679.1-445s1c1
Sequence:CCGGCCACAGGCTGTTGAAATGTAACTCGAGTTACATTTCAACAGCCTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003679.1-1193s1c1
Sequence:CCGGGAGAGATTTCTTCATGCGATTCTCGAGAATCGCATGAAGAAATCTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003679.1-1017s1c1
Sequence:CCGGGCTTGGTATTTGATGAGTTAACTCGAGTTAACTCATCAAATACCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003679.1-644s1c1
Sequence:CCGGCCACCTAAGAACGGAGATTATCTCGAGATAATCTCCGTTCTTAGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432571    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003679.3-1715s21c1
Sequence:CCGGACATGCAGCTTCCCTACATTACTCGAGTAATGTAGGGAAGCTGCATGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003679.3-1372s21c1
Sequence:CCGGGCAGTACCTACCTACTTATACCTCGAGGTATAAGTAGGTAGGTACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416089    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003679.3-1881s21c1
Sequence:CCGGGACTCAACACCTAGGACTAAACTCGAGTTTAGTCCTAGGTGTTGAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003679.3-1442s21c1
Sequence:CCGGGATAGCTCACTTCCGGAATACCTCGAGGTATTCCGGAAGTGAGCTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003679
KMO MISSION shRNA shRNA Plasmid DNA
kynurenine 3-monooxygenase (kynurenine 3-hydroxylase)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003679.1-792s1c1
Sequence:CCGGCCAGTAATGATGTGGTAGATTCTCGAGAATCTACCACATCATTACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003679.1-445s1c1
Sequence:CCGGCCACAGGCTGTTGAAATGTAACTCGAGTTACATTTCAACAGCCTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003679.1-1193s1c1
Sequence:CCGGGAGAGATTTCTTCATGCGATTCTCGAGAATCGCATGAAGAAATCTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003679.1-1017s1c1
Sequence:CCGGGCTTGGTATTTGATGAGTTAACTCGAGTTAACTCATCAAATACCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003679.1-644s1c1
Sequence:CCGGCCACCTAAGAACGGAGATTATCTCGAGATAATCTCCGTTCTTAGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432571    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003679.3-1715s21c1
Sequence:CCGGACATGCAGCTTCCCTACATTACTCGAGTAATGTAGGGAAGCTGCATGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003679.3-1372s21c1
Sequence:CCGGGCAGTACCTACCTACTTATACCTCGAGGTATAAGTAGGTAGGTACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416089    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003679.3-1881s21c1
Sequence:CCGGGACTCAACACCTAGGACTAAACTCGAGTTTAGTCCTAGGTGTTGAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003679.3-1442s21c1
Sequence:CCGGGATAGCTCACTTCCGGAATACCTCGAGGTATTCCGGAAGTGAGCTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003679
KMO MISSION shRNA Lentiviral Transduction Particles
kynurenine 3-monooxygenase (kynurenine 3-hydroxylase)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003679.1-792s1c1
Sequence:CCGGCCAGTAATGATGTGGTAGATTCTCGAGAATCTACCACATCATTACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003679.1-445s1c1
Sequence:CCGGCCACAGGCTGTTGAAATGTAACTCGAGTTACATTTCAACAGCCTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003679.1-1193s1c1
Sequence:CCGGGAGAGATTTCTTCATGCGATTCTCGAGAATCGCATGAAGAAATCTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003679.1-1017s1c1
Sequence:CCGGGCTTGGTATTTGATGAGTTAACTCGAGTTAACTCATCAAATACCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003679.1-644s1c1
Sequence:CCGGCCACCTAAGAACGGAGATTATCTCGAGATAATCTCCGTTCTTAGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432571    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003679.3-1715s21c1
Sequence:CCGGACATGCAGCTTCCCTACATTACTCGAGTAATGTAGGGAAGCTGCATGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003679.3-1372s21c1
Sequence:CCGGGCAGTACCTACCTACTTATACCTCGAGGTATAAGTAGGTAGGTACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416089    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003679.3-1881s21c1
Sequence:CCGGGACTCAACACCTAGGACTAAACTCGAGTTTAGTCCTAGGTGTTGAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003679.3-1442s21c1
Sequence:CCGGGATAGCTCACTTCCGGAATACCTCGAGGTATTCCGGAAGTGAGCTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)