EMAIL THIS PAGE TO A FRIEND

KMT2A

lysine (K)-specific methyltransferase 2A

297 Gene Product Result for
Synonyms: ALL-1 CXXC7 HRX HTRX1 MLL MLL/GAS7 MLL1A TET1-MLL TRX1 WDSTS
Gene ID:
Human(4297) Summary: This gene encodes a transcriptional coactivator that plays an essential role in regulating gene expression during early development and hematopoiesis. The encoded protein contains multiple conserved functional domains. One of these domains, the SET domain, is responsible for its histone H3 lysine 4 (H3K4) methyltransferase activity which mediates chromatin modifications associated with epigenetic transcriptional activation. This protein is processed by the enzyme Taspase 1 into two fragments, MLL-C and MLL-N. These fragments reassociate and further assemble into different multiprotein complexes that regulate the transcription of specific target genes, including many of the HOX genes. Multiple chromosomal translocations involving this gene are the cause of certain acute lymphoid leukemias and acute myeloid leukemias. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Oct 2010]
Mouse(214162) lysine (K)-specific methyltransferase 2A
Rat(315606) lysine (K)-specific methyltransferase 2A
domestic guinea pig(100727230) lysine (K)-specific methyltransferase 2A
naked mole-rat(101716671) lysine (K)-specific methyltransferase 2A
Zebrafish(557048) lysine (K)-specific methyltransferase 2A
cow(508330) lysine (K)-specific methyltransferase 2A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001081049 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081049 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081049 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005933 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005933 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005933 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_110671 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_110671 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_110671 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005933 Rosetta Predictions human pricing
NM_001108139 Rosetta Predictions rat pricing
NM_001081049 Rosetta Predictions mouse pricing
XM_110671 Rosetta Predictions mouse pricing
XM_994852 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005933 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00090459 predicted 1080
2 SASI_Hs02_00340589 predicted 8320
3 SASI_Hs01_00090460 predicted 1343
4 SASI_Hs02_00340590 predicted 6077
5 SASI_Hs01_00090461 predicted 2154
6 SASI_Hs01_00090462 predicted 1059
7 SASI_Hs01_00090463 predicted 1826
8 SASI_Hs02_00340591 predicted 2281
9 SASI_Hs01_00090464 predicted 5626
10 SASI_Hs01_00090465 predicted 5054
11 SASI_Hs01_00090466 predicted 8571
12 SASI_Hs01_00090467 predicted 11837
13 SASI_Hs01_00090468 predicted 7412
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108139 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00235744 predicted 6508
2 SASI_Rn02_00235745 predicted 6731
3 SASI_Rn02_00235746 predicted 1917
4 SASI_Rn02_00235747 predicted 6701
5 SASI_Rn02_00235748 predicted 9938
6 SASI_Rn02_00235749 predicted 4872
7 SASI_Rn02_00235750 predicted 5363
8 SASI_Rn02_00235751 predicted 9096
9 SASI_Rn02_00235752 predicted 11390
10 SASI_Rn02_00235753 predicted 1127
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081049 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00294671 predicted 4839
2 SASI_Mm02_00294672 predicted 7894
3 SASI_Mm02_00294673 predicted 11751
4 SASI_Mm02_00294674 predicted 1915
5 SASI_Mm02_00294675 predicted 2211
6 SASI_Mm02_00294676 predicted 1288
7 SASI_Mm02_00294677 predicted 6928
8 SASI_Mm02_00294678 predicted 11113
9 SASI_Mm02_00294679 predicted 11343
10 SASI_Mm02_00294680 predicted 11284
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_110671 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00284211 predicted 4837
2 SASI_Mm01_00284212 predicted 7903
3 SASI_Mm01_00284213 predicted 11754
4 SASI_Mm01_00284214 predicted 1915
5 SASI_Mm01_00284215 predicted 2210
6 SASI_Mm01_00284216 predicted 1293
7 SASI_Mm01_00284217 predicted 6939
8 SASI_Mm01_00284218 predicted 11119
9 SASI_Mm01_00284219 predicted 11345
10 SASI_Mm01_00284220 predicted 11289
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_994852 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00225625 predicted 2170
2 SASI_Mm01_00225626 predicted 3566
3 SASI_Mm01_00225627 predicted 2483
4 SASI_Mm01_00225628 predicted 3718
5 SASI_Mm01_00225629 predicted 3689
6 SASI_Mm01_00225630 predicted 2571
7 SASI_Mm01_00225631 predicted 2663
8 SASI_Mm01_00225632 predicted 3642
9 SASI_Mm01_00225633 predicted 3363
10 SASI_Mm01_00225634 predicted 3749
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081049
VALIDATED
KMT2A MISSION shRNA Bacterial Glycerol Stock
lysine (K)-specific methyltransferase 2A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000310900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081049.1-1918s21c1
Sequence:CCGGCTGATTCGCAAACCAATATTTCTCGAGAAATATTGGTTTGCGAATCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304372    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081049.1-12012s21c1
Sequence:CCGGGGTCCCTAGTGTCCTACATATCTCGAGATATGTAGGACACTAGGGACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081049.1-8003s21c1
Sequence:CCGGACGAAGATGACTTATACTATTCTCGAGAATAGTATAAGTCATCTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081049.1-5381s21c1
Sequence:CCGGCGCCTTCACTTGACCATAATTCTCGAGAATTATGGTCAAGTGAAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081049.1-11445s21c1
Sequence:CCGGGCACTTGAAGAAGACTTCTAACTCGAGTTAGAAGTCTTCTTCAAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081049
VALIDATED
KMT2A MISSION shRNA shRNA Plasmid DNA
lysine (K)-specific methyltransferase 2A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000310900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081049.1-1918s21c1
Sequence:CCGGCTGATTCGCAAACCAATATTTCTCGAGAAATATTGGTTTGCGAATCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304372    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081049.1-12012s21c1
Sequence:CCGGGGTCCCTAGTGTCCTACATATCTCGAGATATGTAGGACACTAGGGACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081049.1-8003s21c1
Sequence:CCGGACGAAGATGACTTATACTATTCTCGAGAATAGTATAAGTCATCTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081049.1-5381s21c1
Sequence:CCGGCGCCTTCACTTGACCATAATTCTCGAGAATTATGGTCAAGTGAAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081049.1-11445s21c1
Sequence:CCGGGCACTTGAAGAAGACTTCTAACTCGAGTTAGAAGTCTTCTTCAAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081049
VALIDATED
KMT2A MISSION shRNA Lentiviral Transduction Particles
lysine (K)-specific methyltransferase 2A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000310900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081049.1-1918s21c1
Sequence:CCGGCTGATTCGCAAACCAATATTTCTCGAGAAATATTGGTTTGCGAATCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304372    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081049.1-12012s21c1
Sequence:CCGGGGTCCCTAGTGTCCTACATATCTCGAGATATGTAGGACACTAGGGACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081049.1-8003s21c1
Sequence:CCGGACGAAGATGACTTATACTATTCTCGAGAATAGTATAAGTCATCTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081049.1-5381s21c1
Sequence:CCGGCGCCTTCACTTGACCATAATTCTCGAGAATTATGGTCAAGTGAAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081049.1-11445s21c1
Sequence:CCGGGCACTTGAAGAAGACTTCTAACTCGAGTTAGAAGTCTTCTTCAAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005933
VALIDATED
KMT2A MISSION shRNA Bacterial Glycerol Stock
lysine (K)-specific methyltransferase 2A
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005933.2-6455s21c1
Sequence:CCGGGATTCGAACACCCAGTTATTCCTCGAGGAATAACTGGGTGTTCGAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234744    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005933.2-12214s21c1
Sequence:CCGGTGCCTGGAAGGAGCCTATTATCTCGAGATAATAGGCTCCTTCCAGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005933.2-11231s21c1
Sequence:CCGGTGCCAAGCACTGTCGAAATTACTCGAGTAATTTCGACAGTGCTTGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005933.2-8108s21c1
Sequence:CCGGACGACTGGCATCCCATAATTTCTCGAGAAATTATGGGATGCCAGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_005933.2-1320s21c1
Sequence:CCGGGATTATGACCCTCCAATTAAACTCGAGTTTAATTGGAGGGTCATAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_005933.1-2990s1c1
Sequence:CCGGGCACTGTTAAACATTCCACTTCTCGAGAAGTGGAATGTTTAACAGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005933.1-9118s1c1
Sequence:CCGGCCCATCCAGAACCAGAAGTATCTCGAGATACTTCTGGTTCTGGATGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_005933.1-915s1c1
Sequence:CCGGGCCTCCATCAACAGAAAGGATCTCGAGATCCTTTCTGTTGATGGAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_005933.1-11113s1c1
Sequence:CCGGCGCCTAAAGCAGCTCTCATTTCTCGAGAAATGAGAGCTGCTTTAGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005933.1-4099s1c1
Sequence:CCGGCCGGTCAATAAGCAGGAGAATCTCGAGATTCTCCTGCTTATTGACCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005933
VALIDATED
KMT2A MISSION shRNA shRNA Plasmid DNA
lysine (K)-specific methyltransferase 2A
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005933.2-6455s21c1
Sequence:CCGGGATTCGAACACCCAGTTATTCCTCGAGGAATAACTGGGTGTTCGAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234744    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005933.2-12214s21c1
Sequence:CCGGTGCCTGGAAGGAGCCTATTATCTCGAGATAATAGGCTCCTTCCAGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005933.2-11231s21c1
Sequence:CCGGTGCCAAGCACTGTCGAAATTACTCGAGTAATTTCGACAGTGCTTGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005933.2-8108s21c1
Sequence:CCGGACGACTGGCATCCCATAATTTCTCGAGAAATTATGGGATGCCAGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_005933.2-1320s21c1
Sequence:CCGGGATTATGACCCTCCAATTAAACTCGAGTTTAATTGGAGGGTCATAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_005933.1-2990s1c1
Sequence:CCGGGCACTGTTAAACATTCCACTTCTCGAGAAGTGGAATGTTTAACAGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005933.1-9118s1c1
Sequence:CCGGCCCATCCAGAACCAGAAGTATCTCGAGATACTTCTGGTTCTGGATGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_005933.1-915s1c1
Sequence:CCGGGCCTCCATCAACAGAAAGGATCTCGAGATCCTTTCTGTTGATGGAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_005933.1-11113s1c1
Sequence:CCGGCGCCTAAAGCAGCTCTCATTTCTCGAGAAATGAGAGCTGCTTTAGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005933.1-4099s1c1
Sequence:CCGGCCGGTCAATAAGCAGGAGAATCTCGAGATTCTCCTGCTTATTGACCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005933
VALIDATED
KMT2A MISSION shRNA Lentiviral Transduction Particles
lysine (K)-specific methyltransferase 2A
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005933.2-6455s21c1
Sequence:CCGGGATTCGAACACCCAGTTATTCCTCGAGGAATAACTGGGTGTTCGAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234744    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005933.2-12214s21c1
Sequence:CCGGTGCCTGGAAGGAGCCTATTATCTCGAGATAATAGGCTCCTTCCAGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005933.2-11231s21c1
Sequence:CCGGTGCCAAGCACTGTCGAAATTACTCGAGTAATTTCGACAGTGCTTGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005933.2-8108s21c1
Sequence:CCGGACGACTGGCATCCCATAATTTCTCGAGAAATTATGGGATGCCAGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_005933.2-1320s21c1
Sequence:CCGGGATTATGACCCTCCAATTAAACTCGAGTTTAATTGGAGGGTCATAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_005933.1-2990s1c1
Sequence:CCGGGCACTGTTAAACATTCCACTTCTCGAGAAGTGGAATGTTTAACAGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005933.1-9118s1c1
Sequence:CCGGCCCATCCAGAACCAGAAGTATCTCGAGATACTTCTGGTTCTGGATGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_005933.1-915s1c1
Sequence:CCGGGCCTCCATCAACAGAAAGGATCTCGAGATCCTTTCTGTTGATGGAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_005933.1-11113s1c1
Sequence:CCGGCGCCTAAAGCAGCTCTCATTTCTCGAGAAATGAGAGCTGCTTTAGGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005933.1-4099s1c1
Sequence:CCGGCCGGTCAATAAGCAGGAGAATCTCGAGATTCTCCTGCTTATTGACCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_110671
VALIDATED
KMT2A MISSION shRNA Bacterial Glycerol Stock
lysine (K)-specific methyltransferase 2A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_110671.2-5114s1c1
Sequence:CCGGCGCCTTCACTTGACCATAATTCTCGAGAATTATGGTCAAGTGAAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_110671.2-11178s1c1
Sequence:CCGGGCACTTGAAGAAGACTTCTAACTCGAGTTAGAAGTCTTCTTCAAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_110671.2-3257s1c1
Sequence:CCGGGCCGCAATATAAAGAAGCAATCTCGAGATTGCTTCTTTATATTGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034424    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_110671.2-13036s1c1
Sequence:CCGGCGCGGTATTATCCTAATTTAACTCGAGTTAAATTAGGATAATACCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_110671.2-3820s1c1
Sequence:CCGGCCAGTAAGTAAACAAGAGAATCTCGAGATTCTCTTGTTTACTTACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_110671
VALIDATED
KMT2A MISSION shRNA shRNA Plasmid DNA
lysine (K)-specific methyltransferase 2A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_110671.2-5114s1c1
Sequence:CCGGCGCCTTCACTTGACCATAATTCTCGAGAATTATGGTCAAGTGAAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_110671.2-11178s1c1
Sequence:CCGGGCACTTGAAGAAGACTTCTAACTCGAGTTAGAAGTCTTCTTCAAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_110671.2-3257s1c1
Sequence:CCGGGCCGCAATATAAAGAAGCAATCTCGAGATTGCTTCTTTATATTGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034424    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_110671.2-13036s1c1
Sequence:CCGGCGCGGTATTATCCTAATTTAACTCGAGTTAAATTAGGATAATACCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_110671.2-3820s1c1
Sequence:CCGGCCAGTAAGTAAACAAGAGAATCTCGAGATTCTCTTGTTTACTTACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_110671
VALIDATED
KMT2A MISSION shRNA Lentiviral Transduction Particles
lysine (K)-specific methyltransferase 2A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_110671.2-5114s1c1
Sequence:CCGGCGCCTTCACTTGACCATAATTCTCGAGAATTATGGTCAAGTGAAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_110671.2-11178s1c1
Sequence:CCGGGCACTTGAAGAAGACTTCTAACTCGAGTTAGAAGTCTTCTTCAAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_110671.2-3257s1c1
Sequence:CCGGGCCGCAATATAAAGAAGCAATCTCGAGATTGCTTCTTTATATTGCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034424    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_110671.2-13036s1c1
Sequence:CCGGCGCGGTATTATCCTAATTTAACTCGAGTTAAATTAGGATAATACCGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_110671.2-3820s1c1
Sequence:CCGGCCAGTAAGTAAACAAGAGAATCTCGAGATTCTCTTGTTTACTTACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)