EMAIL THIS PAGE TO A FRIEND

KMT2B

lysine (K)-specific methyltransferase 2B

239 Gene Product Result for
Synonyms: HRX2 MLL1B MLL2 MLL4 TRX2 WBP7
Gene ID:
Human(9757) Summary: This gene encodes a protein which contains multiple domains including a CXXC zinc finger, three PHD zinc fingers, two FY-rich domains, and a SET (suppressor of variegation, enhancer of zeste, and trithorax) domain. The SET domain is a conserved C-terminal domain that characterizes proteins of the MLL (mixed-lineage leukemia) family. This gene is ubiquitously expressed in adult tissues. It is also amplified in solid tumor cell lines, and may be involved in human cancer. Two alternatively spliced transcript variants encoding distinct isoforms have been reported for this gene, however, the full length nature of the shorter transcript is not known. [provided by RefSeq, Jul 2008]
Mouse(75410) lysine (K)-specific methyltransferase 2B
Rat(361543) lysine (K)-specific methyltransferase 2B
cow(785776) lysine (K)-specific methyltransferase 2B
domestic guinea pig(100735175) lysine (K)-specific methyltransferase 2B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014727 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014727 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014727 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_194342 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_194342 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_194342 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_029274 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029274 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029274 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014727 Rosetta Predictions human pricing
XM_341829 Rosetta Predictions rat pricing
XR_009278 Rosetta Predictions rat pricing
NM_029274 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014727 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00240396 predicted 5589
2 SASI_Hs01_00240397 predicted 2491
3 SASI_Hs01_00240398 predicted 7890
4 SASI_Hs01_00240399 predicted 4372
5 SASI_Hs01_00240400 predicted 5104
6 SASI_Hs01_00240401 predicted 5316
7 SASI_Hs01_00240402 predicted 1557
8 SASI_Hs01_00240403 predicted 3923
9 SASI_Hs01_00240404 predicted 3523
10 SASI_Hs01_00240405 predicted 4028
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341829 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00393403 predicted 6307
2 SASI_Rn02_00393404 predicted 4005
3 SASI_Rn02_00393405 predicted 5118
4 SASI_Rn02_00393406 predicted 7551
5 SASI_Rn02_00393407 predicted 4366
6 SASI_Rn02_00393408 predicted 5323
7 SASI_Rn02_00393409 predicted 7856
8 SASI_Rn02_00393410 predicted 5190
9 SASI_Rn02_00393411 predicted 4538
10 SASI_Rn02_00393412 predicted 7146
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_009278 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00419278 predicted 6733
2 SASI_Rn01_00160449 predicted 4428
3 SASI_Rn01_00160450 predicted 5533
4 SASI_Rn01_00160451 predicted 7971
5 SASI_Rn01_00160452 predicted 4791
6 SASI_Rn01_00160454 predicted 5744
7 SASI_Rn01_00160455 predicted 8275
8 SASI_Rn02_00419279 predicted 5614
9 SASI_Rn01_00160456 predicted 4963
10 SASI_Rn01_00160457 predicted 7574
11 SASI_Rn01_00160453 predicted 2004
12 SASI_Rn01_00160458 predicted 4358
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029274 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00080049 predicted 7800
2 SASI_Mm02_00335051 predicted 3277
3 SASI_Mm01_00080050 predicted 7557
4 SASI_Mm01_00080051 predicted 5347
5 SASI_Mm02_00335052 predicted 2964
6 SASI_Mm01_00080052 predicted 7855
7 SASI_Mm01_00080053 predicted 7676
8 SASI_Mm01_00080054 predicted 3957
9 SASI_Mm01_00080055 predicted 4049
10 SASI_Mm01_00080056 predicted 5135
11 SASI_Mm01_00080057 predicted 6920
12 SASI_Mm01_00080058 predicted 6767
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014727
KMT2B MISSION shRNA Bacterial Glycerol Stock
lysine (K)-specific methyltransferase 2B
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000005958    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014727.1-8253s1c1
Sequence:CCGGACCCTCATGTTCAGGGTGGATCTCGAGATCCACCCTGAACATGAGGGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014727.1-7455s1c1
Sequence:CCGGCCAGCACTATAAGTTCCGTTACTCGAGTAACGGAACTTATAGTGCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014727.1-3986s1c1
Sequence:CCGGCCCAGCTATATGAGAAAGGAACTCGAGTTCCTTTCTCATATAGCTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014727.1-1560s1c1
Sequence:CCGGCCTGAAGAATATCCGGCAGTTCTCGAGAACTGCCGGATATTCTTCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014727.1-7894s1c1
Sequence:CCGGCGCATGGATGACTTTGATGTACTCGAGTACATCAAAGTCATCCATGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014727.1-1562s21c1
Sequence:CCGGTGAAGAATATCCGGCAGTTTACTCGAGTAAACTGCCGGATATTCTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014727.1-7869s21c1
Sequence:CCGGGAAGGGCATCGGGTGCTATATCTCGAGATATAGCACCCGATGCCCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014727
KMT2B MISSION shRNA shRNA Plasmid DNA
lysine (K)-specific methyltransferase 2B
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000005958    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014727.1-8253s1c1
Sequence:CCGGACCCTCATGTTCAGGGTGGATCTCGAGATCCACCCTGAACATGAGGGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014727.1-7455s1c1
Sequence:CCGGCCAGCACTATAAGTTCCGTTACTCGAGTAACGGAACTTATAGTGCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014727.1-3986s1c1
Sequence:CCGGCCCAGCTATATGAGAAAGGAACTCGAGTTCCTTTCTCATATAGCTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014727.1-1560s1c1
Sequence:CCGGCCTGAAGAATATCCGGCAGTTCTCGAGAACTGCCGGATATTCTTCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014727.1-7894s1c1
Sequence:CCGGCGCATGGATGACTTTGATGTACTCGAGTACATCAAAGTCATCCATGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014727.1-1562s21c1
Sequence:CCGGTGAAGAATATCCGGCAGTTTACTCGAGTAAACTGCCGGATATTCTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014727.1-7869s21c1
Sequence:CCGGGAAGGGCATCGGGTGCTATATCTCGAGATATAGCACCCGATGCCCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014727
KMT2B MISSION shRNA Lentiviral Transduction Particles
lysine (K)-specific methyltransferase 2B
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000005958    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014727.1-8253s1c1
Sequence:CCGGACCCTCATGTTCAGGGTGGATCTCGAGATCCACCCTGAACATGAGGGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014727.1-7455s1c1
Sequence:CCGGCCAGCACTATAAGTTCCGTTACTCGAGTAACGGAACTTATAGTGCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014727.1-3986s1c1
Sequence:CCGGCCCAGCTATATGAGAAAGGAACTCGAGTTCCTTTCTCATATAGCTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014727.1-1560s1c1
Sequence:CCGGCCTGAAGAATATCCGGCAGTTCTCGAGAACTGCCGGATATTCTTCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014727.1-7894s1c1
Sequence:CCGGCGCATGGATGACTTTGATGTACTCGAGTACATCAAAGTCATCCATGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014727.1-1562s21c1
Sequence:CCGGTGAAGAATATCCGGCAGTTTACTCGAGTAAACTGCCGGATATTCTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014727.1-7869s21c1
Sequence:CCGGGAAGGGCATCGGGTGCTATATCTCGAGATATAGCACCCGATGCCCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_194342
VALIDATED
KMT2B MISSION shRNA Bacterial Glycerol Stock
lysine (K)-specific methyltransferase 2B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034404    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_194342.3-6975s1c1
Sequence:CCGGAGTCTCAGTATCTCACTCCTACTCGAGTAGGAGTGAGATACTGAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194342.3-6312s1c1
Sequence:CCGGCCGGAAGTGTACCTTTGACATCTCGAGATGTCAAAGGTACACTTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194342.3-584s1c1
Sequence:CCGGCCCTTATGATCAAGTTTGTTTCTCGAGAAACAAACTTGATCATAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194342.3-4093s1c1
Sequence:CCGGCGGTGCCGAATTCTAGAGTATCTCGAGATACTCTAGAATTCGGCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_194342.3-5088s1c1
Sequence:CCGGGCCTTCAGAAATTGTGGATTTCTCGAGAAATCCACAATTTCTGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_194342
VALIDATED
KMT2B MISSION shRNA shRNA Plasmid DNA
lysine (K)-specific methyltransferase 2B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034404    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_194342.3-6975s1c1
Sequence:CCGGAGTCTCAGTATCTCACTCCTACTCGAGTAGGAGTGAGATACTGAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194342.3-6312s1c1
Sequence:CCGGCCGGAAGTGTACCTTTGACATCTCGAGATGTCAAAGGTACACTTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194342.3-584s1c1
Sequence:CCGGCCCTTATGATCAAGTTTGTTTCTCGAGAAACAAACTTGATCATAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194342.3-4093s1c1
Sequence:CCGGCGGTGCCGAATTCTAGAGTATCTCGAGATACTCTAGAATTCGGCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_194342.3-5088s1c1
Sequence:CCGGGCCTTCAGAAATTGTGGATTTCTCGAGAAATCCACAATTTCTGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_194342
VALIDATED
KMT2B MISSION shRNA Lentiviral Transduction Particles
lysine (K)-specific methyltransferase 2B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034404    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_194342.3-6975s1c1
Sequence:CCGGAGTCTCAGTATCTCACTCCTACTCGAGTAGGAGTGAGATACTGAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194342.3-6312s1c1
Sequence:CCGGCCGGAAGTGTACCTTTGACATCTCGAGATGTCAAAGGTACACTTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194342.3-584s1c1
Sequence:CCGGCCCTTATGATCAAGTTTGTTTCTCGAGAAACAAACTTGATCATAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194342.3-4093s1c1
Sequence:CCGGCGGTGCCGAATTCTAGAGTATCTCGAGATACTCTAGAATTCGGCACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_194342.3-5088s1c1
Sequence:CCGGGCCTTCAGAAATTGTGGATTTCTCGAGAAATCCACAATTTCTGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029274
KMT2B MISSION shRNA Bacterial Glycerol Stock
lysine (K)-specific methyltransferase 2B
Mouse
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000427977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029274.2-5300s21c1
Sequence:CCGGACCAATGCTCCCGCCTGTATTCTCGAGAATACAGGCGGGAGCATTGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029274.2-1604s21c1
Sequence:CCGGAGAATATACGGCAGTTTATTACTCGAGTAATAAACTGCCGTATATTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029274
KMT2B MISSION shRNA shRNA Plasmid DNA
lysine (K)-specific methyltransferase 2B
Mouse
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000427977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029274.2-5300s21c1
Sequence:CCGGACCAATGCTCCCGCCTGTATTCTCGAGAATACAGGCGGGAGCATTGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029274.2-1604s21c1
Sequence:CCGGAGAATATACGGCAGTTTATTACTCGAGTAATAAACTGCCGTATATTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029274
KMT2B MISSION shRNA Lentiviral Transduction Particles
lysine (K)-specific methyltransferase 2B
Mouse
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000427977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029274.2-5300s21c1
Sequence:CCGGACCAATGCTCCCGCCTGTATTCTCGAGAATACAGGCGGGAGCATTGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029274.2-1604s21c1
Sequence:CCGGAGAATATACGGCAGTTTATTACTCGAGTAATAAACTGCCGTATATTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)