EMAIL THIS PAGE TO A FRIEND

KMT2E

lysine (K)-specific methyltransferase 2E

156 Gene Product Result for
Synonyms: HDCMC04P MLL5
Gene ID:
Human(55904) Summary: This gene is a member of the myeloid/lymphoid or mixed-lineage leukemia (MLL) family and encodes a protein with an N-terminal PHD zinc finger and a central SET domain. Overexpression of the protein inhibits cell cycle progression. Alternate transcriptional splice variants have been characterized. [provided by RefSeq, Jul 2008]
Mouse(69188) lysine (K)-specific methyltransferase 2E
Rat(311968) lysine (K)-specific methyltransferase 2E
domestic guinea pig(100722538) lysine (K)-specific methyltransferase 2E
naked mole-rat(101712321) lysine (K)-specific methyltransferase 2E
Zebrafish(325395) lysine (K)-specific methyltransferase 2E
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018682 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018682 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018682 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_893956 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_893956 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_893956 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018682 Rosetta Predictions human pricing
NM_182931 Rosetta Predictions human pricing
XM_001059647 Rosetta Predictions rat pricing
XM_001059700 Rosetta Predictions rat pricing
XM_231287 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018682 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00238555 predicted 3910
2 SASI_Hs01_00238558 predicted 726
3 SASI_Hs02_00352193 predicted 4902
4 SASI_Hs02_00352194 predicted 1437
5 SASI_Hs02_00352195 predicted 3289
6 SASI_Hs01_00238560 predicted 1159
7 SASI_Hs01_00238561 predicted 4528
8 SASI_Hs01_00238562 predicted 931
9 SASI_Hs01_00238563 predicted 3904
10 SASI_Hs01_00238564 predicted 1598
11 SASI_Hs01_00238556 predicted 1381
12 SASI_Hs01_00238557 predicted 2543
13 SASI_Hs01_00238559 predicted 4104
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182931 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00203204 predicted 4063
2 SASI_Hs01_00203207 predicted 882
3 SASI_Hs02_00371063 predicted 5050
4 SASI_Hs02_00371064 predicted 1582
5 SASI_Hs02_00371065 predicted 3446
6 SASI_Hs01_00203209 predicted 1313
7 SASI_Hs01_00203210 predicted 4678
8 SASI_Hs01_00203211 predicted 1080
9 SASI_Hs01_00203212 predicted 4044
10 SASI_Hs01_00203213 predicted 1737
11 SASI_Hs01_00203205 predicted 1527
12 SASI_Hs01_00203206 predicted 2684
13 SASI_Hs01_00203208 predicted 4250
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059647 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00293827 predicted 2669
2 SASI_Rn02_00293828 predicted 956
3 SASI_Rn02_00293829 predicted 1456
4 SASI_Rn02_00293830 predicted 3133
5 SASI_Rn02_00293831 predicted 5410
6 SASI_Rn02_00293832 predicted 3008
7 SASI_Rn02_00293833 predicted 871
8 SASI_Rn02_00293834 predicted 4043
9 SASI_Rn02_00293835 predicted 1665
10 SASI_Rn02_00293836 predicted 3844
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059700 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00294008 predicted 2601
2 SASI_Rn02_00294009 predicted 895
3 SASI_Rn02_00294010 predicted 1397
4 SASI_Rn02_00294011 predicted 3071
5 SASI_Rn02_00294012 predicted 5352
6 SASI_Rn02_00294013 predicted 2944
7 SASI_Rn02_00294014 predicted 808
8 SASI_Rn02_00294015 predicted 3985
9 SASI_Rn02_00294016 predicted 1603
10 SASI_Rn02_00294017 predicted 3783
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_231287 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00386724 predicted 745
2 SASI_Rn02_00386725 predicted 624
3 SASI_Rn02_00386726 predicted 801
4 SASI_Rn02_00386727 predicted 692
5 SASI_Rn02_00386728 predicted 897
6 SASI_Rn02_00386729 predicted 864
7 SASI_Rn02_00386730 predicted 618
8 SASI_Rn02_00386731 predicted 898
9 SASI_Rn02_00386732 predicted 855
10 SASI_Rn02_00386733 predicted 815
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018682
VALIDATED
KMT2E MISSION shRNA Bacterial Glycerol Stock
lysine (K)-specific methyltransferase 2E
Human
17 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000358557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018682.3-5910s21c1
Sequence:CCGGGCACAGGTGCCACCAACATTTCTCGAGAAATGTTGGTGGCACCTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018682.3-1487s21c1
Sequence:CCGGGTTTGAAGCAAATGGGTATTTCTCGAGAAATACCCATTTGCTTCAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018682.3-3476s21c1
Sequence:CCGGTGAGCCAACTGCCCTACATAACTCGAGTTATGTAGGGCAGTTGGCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018682.3-1375s21c1
Sequence:CCGGCTCCTGTAGAGAGCCATATACCTCGAGGTATATGGCTCTCTACAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018682.3-2735s21c1
Sequence:GTACCGGATACTCCACTCCTAAGCATTACTCGAGTAATGCTTAGGAGTGGAGTATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230230    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018682.3-6357s21c1
Sequence:CCGGTGAATGCATCTTAGGTATAAACTCGAGTTTATACCTAAGATGCATTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018682.3-3076s21c1
Sequence:CCGGCACCAACTCACACCGATATTACTCGAGTAATATCGGTGTGAGTTGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018682.3-797s21c1
Sequence:CCGGATGCAGCGTTTGGCAACATATCTCGAGATATGTTGCCAAACGCTGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018682.3-563s21c1
Sequence:CCGGGCCCTATGCGGACCATAATTACTCGAGTAATTATGGTCCGCATAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018682.3-3681s21c1
Sequence:CCGGTTCCGAATAAGTGAGTCAAAGCTCGAGCTTTGACTCACTTATTCGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018682.3-829s21c1
Sequence:CCGGGGATTGATAGGCAGCATATTCCTCGAGGAATATGCTGCCTATCAATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018682.3-3758s21c1
Sequence:CCGGTTCCGAAGATGGGCTTGTATCCTCGAGGATACAAGCCCATCTTCGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018682.2-2470s1c1
Sequence:CCGGCCTCTACGCATAACTACAGATCTCGAGATCTGTAGTTATGCGTAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150550    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018682.2-6024s1c1
Sequence:CCGGGCTGATTTGATGCTGTATGATCTCGAGATCATACAGCATCAAATCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_018682.2-2783s1c1
Sequence:CCGGGCTGTTCCCTTCCAGATTTAACTCGAGTTAAATCTGGAAGGGAACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018682.2-3572s1c1
Sequence:CCGGCTTCCGAAGATGGGCTTGTATCTCGAGATACAAGCCCATCTTCGGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018682.2-293s1c1
Sequence:CCGGGCCCTGTGGTAGTTGAGAAATCTCGAGATTTCTCAACTACCACAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018682
VALIDATED
KMT2E MISSION shRNA shRNA Plasmid DNA
lysine (K)-specific methyltransferase 2E
Human
17 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000358557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018682.3-5910s21c1
Sequence:CCGGGCACAGGTGCCACCAACATTTCTCGAGAAATGTTGGTGGCACCTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018682.3-1487s21c1
Sequence:CCGGGTTTGAAGCAAATGGGTATTTCTCGAGAAATACCCATTTGCTTCAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018682.3-3476s21c1
Sequence:CCGGTGAGCCAACTGCCCTACATAACTCGAGTTATGTAGGGCAGTTGGCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018682.3-1375s21c1
Sequence:CCGGCTCCTGTAGAGAGCCATATACCTCGAGGTATATGGCTCTCTACAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018682.3-2735s21c1
Sequence:GTACCGGATACTCCACTCCTAAGCATTACTCGAGTAATGCTTAGGAGTGGAGTATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230230    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018682.3-6357s21c1
Sequence:CCGGTGAATGCATCTTAGGTATAAACTCGAGTTTATACCTAAGATGCATTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018682.3-3076s21c1
Sequence:CCGGCACCAACTCACACCGATATTACTCGAGTAATATCGGTGTGAGTTGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018682.3-797s21c1
Sequence:CCGGATGCAGCGTTTGGCAACATATCTCGAGATATGTTGCCAAACGCTGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018682.3-563s21c1
Sequence:CCGGGCCCTATGCGGACCATAATTACTCGAGTAATTATGGTCCGCATAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018682.3-3681s21c1
Sequence:CCGGTTCCGAATAAGTGAGTCAAAGCTCGAGCTTTGACTCACTTATTCGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018682.3-829s21c1
Sequence:CCGGGGATTGATAGGCAGCATATTCCTCGAGGAATATGCTGCCTATCAATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018682.3-3758s21c1
Sequence:CCGGTTCCGAAGATGGGCTTGTATCCTCGAGGATACAAGCCCATCTTCGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018682.2-2470s1c1
Sequence:CCGGCCTCTACGCATAACTACAGATCTCGAGATCTGTAGTTATGCGTAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150550    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018682.2-6024s1c1
Sequence:CCGGGCTGATTTGATGCTGTATGATCTCGAGATCATACAGCATCAAATCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_018682.2-2783s1c1
Sequence:CCGGGCTGTTCCCTTCCAGATTTAACTCGAGTTAAATCTGGAAGGGAACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018682.2-3572s1c1
Sequence:CCGGCTTCCGAAGATGGGCTTGTATCTCGAGATACAAGCCCATCTTCGGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018682.2-293s1c1
Sequence:CCGGGCCCTGTGGTAGTTGAGAAATCTCGAGATTTCTCAACTACCACAGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018682
VALIDATED
KMT2E MISSION shRNA Lentiviral Transduction Particles
lysine (K)-specific methyltransferase 2E
Human
17 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000358557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018682.3-5910s21c1
Sequence:CCGGGCACAGGTGCCACCAACATTTCTCGAGAAATGTTGGTGGCACCTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018682.3-1487s21c1
Sequence:CCGGGTTTGAAGCAAATGGGTATTTCTCGAGAAATACCCATTTGCTTCAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018682.3-3476s21c1
Sequence:CCGGTGAGCCAACTGCCCTACATAACTCGAGTTATGTAGGGCAGTTGGCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018682.3-1375s21c1
Sequence:CCGGCTCCTGTAGAGAGCCATATACCTCGAGGTATATGGCTCTCTACAGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018682.3-2735s21c1
Sequence:GTACCGGATACTCCACTCCTAAGCATTACTCGAGTAATGCTTAGGAGTGGAGTATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230230    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018682.3-6357s21c1
Sequence:CCGGTGAATGCATCTTAGGTATAAACTCGAGTTTATACCTAAGATGCATTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018682.3-3076s21c1
Sequence:CCGGCACCAACTCACACCGATATTACTCGAGTAATATCGGTGTGAGTTGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018682.3-797s21c1
Sequence:CCGGATGCAGCGTTTGGCAACATATCTCGAGATATGTTGCCAAACGCTGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018682.3-563s21c1
Sequence:CCGGGCCCTATGCGGACCATAATTACTCGAGTAATTATGGTCCGCATAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018682.3-3681s21c1
Sequence:CCGGTTCCGAATAAGTGAGTCAAAGCTCGAGCTTTGACTCACTTATTCGGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018682.3-829s21c1
Sequence:CCGGGGATTGATAGGCAGCATATTCCTCGAGGAATATGCTGCCTATCAATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018682.3-3758s21c1
Sequence:CCGGTTCCGAAGATGGGCTTGTATCCTCGAGGATACAAGCCCATCTTCGGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018682.2-2470s1c1
Sequence:CCGGCCTCTACGCATAACTACAGATCTCGAGATCTGTAGTTATGCGTAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150550    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018682.2-6024s1c1
Sequence:CCGGGCTGATTTGATGCTGTATGATCTCGAGATCATACAGCATCAAATCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_018682.2-2783s1c1
Sequence:CCGGGCTGTTCCCTTCCAGATTTAACTCGAGTTAAATCTGGAAGGGAACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018682.2-3572s1c1
Sequence:CCGGCTTCCGAAGATGGGCTTGTATCTCGAGATACAAGCCCATCTTCGGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018682.2-293s1c1
Sequence:CCGGGCCCTGTGGTAGTTGAGAAATCTCGAGATTTCTCAACTACCACAGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_893956
VALIDATED
KMT2E MISSION shRNA Bacterial Glycerol Stock
lysine (K)-specific methyltransferase 2E
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000241165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:XM_893956.1-5021s21c1
Sequence:CCGGGCAACTTCTGGAGCGTTATTTCTCGAGAAATAACGCTCCAGAAGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:XM_893956.1-1094s21c1
Sequence:CCGGACTCCAACTTCAATCACTTTACTCGAGTAAAGTGATTGAAGTTGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_893956.1-646s21c1
Sequence:CCGGGCCCTATGCGGACCATAATTACTCGAGTAATTATGGTCCGCATAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241162    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_893956.1-6291s21c1
Sequence:CCGGAGCCAGCTGTAGGTATCTTTACTCGAGTAAAGATACCTACAGCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:XM_893956.1-880s21c1
Sequence:CCGGATGCAGTGTTTGGCAACATATCTCGAGATATGTTGCCAAACACTGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_893956
VALIDATED
KMT2E MISSION shRNA shRNA Plasmid DNA
lysine (K)-specific methyltransferase 2E
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000241165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:XM_893956.1-5021s21c1
Sequence:CCGGGCAACTTCTGGAGCGTTATTTCTCGAGAAATAACGCTCCAGAAGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:XM_893956.1-1094s21c1
Sequence:CCGGACTCCAACTTCAATCACTTTACTCGAGTAAAGTGATTGAAGTTGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_893956.1-646s21c1
Sequence:CCGGGCCCTATGCGGACCATAATTACTCGAGTAATTATGGTCCGCATAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241162    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_893956.1-6291s21c1
Sequence:CCGGAGCCAGCTGTAGGTATCTTTACTCGAGTAAAGATACCTACAGCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:XM_893956.1-880s21c1
Sequence:CCGGATGCAGTGTTTGGCAACATATCTCGAGATATGTTGCCAAACACTGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_893956
VALIDATED
KMT2E MISSION shRNA Lentiviral Transduction Particles
lysine (K)-specific methyltransferase 2E
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000241165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:XM_893956.1-5021s21c1
Sequence:CCGGGCAACTTCTGGAGCGTTATTTCTCGAGAAATAACGCTCCAGAAGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:XM_893956.1-1094s21c1
Sequence:CCGGACTCCAACTTCAATCACTTTACTCGAGTAAAGTGATTGAAGTTGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_893956.1-646s21c1
Sequence:CCGGGCCCTATGCGGACCATAATTACTCGAGTAATTATGGTCCGCATAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241162    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_893956.1-6291s21c1
Sequence:CCGGAGCCAGCTGTAGGTATCTTTACTCGAGTAAAGATACCTACAGCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:XM_893956.1-880s21c1
Sequence:CCGGATGCAGTGTTTGGCAACATATCTCGAGATATGTTGCCAAACACTGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)