EMAIL THIS PAGE TO A FRIEND

KNCN

kinocilin

40 Gene Product Result for
Synonyms: Kino L5
UniProtKB ID: A6PVL3, A8MXE3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001039124 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001039124 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001039124 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001097611 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001097611 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001097611 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001097611 Rosetta Predictions human pricing
NM_182516 Rosetta Predictions human pricing
NM_001039124 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001097611 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318410 predicted 599
2 SASI_Hs02_00318411 predicted 596
3 SASI_Hs02_00318412 predicted 573
4 SASI_Hs02_00318413 predicted 600
5 SASI_Hs02_00318414 predicted 606
6 SASI_Hs02_00318415 predicted 541
7 SASI_Hs02_00318416 predicted 594
8 SASI_Hs02_00318417 predicted 425
9 SASI_Hs02_00318418 predicted 242
10 SASI_Hs02_00318419 predicted 643
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182516 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00152269 predicted 524
2 SASI_Hs01_00152270 predicted 522
3 SASI_Hs01_00152271 predicted 506
4 SASI_Hs01_00152272 predicted 540
5 SASI_Hs01_00152273 predicted 533
6 SASI_Hs01_00152274 predicted 427
7 SASI_Hs01_00152275 predicted 473
8 SASI_Hs01_00152276 predicted 525
9 SASI_Hs01_00152277 predicted 240
10 SASI_Hs01_00152278 predicted 361
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039124 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00024712 predicted 560
2 SASI_Mm01_00024713 predicted 698
3 SASI_Mm01_00024714 predicted 407
4 SASI_Mm01_00024715 predicted 349
5 SASI_Mm01_00024716 predicted 525
6 SASI_Mm01_00024717 predicted 602
7 SASI_Mm02_00289815 predicted 518
8 SASI_Mm01_00024719 predicted 537
9 SASI_Mm01_00024720 predicted 550
10 SASI_Mm01_00024721 predicted 532
11 SASI_Mm01_00024718 predicted 611
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039124
KNCN MISSION shRNA Bacterial Glycerol Stock
kinocilin
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039124.2-565s21c1
Sequence:CCGGTGAGAATCCATCCTAACTCAGCTCGAGCTGAGTTAGGATGGATTCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039124.2-449s21c1
Sequence:CCGGTGCTGCTGTGGGTGGTATCTTCTCGAGAAGATACCACCCACAGCAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039124.2-524s21c1
Sequence:CCGGTCGGTTCAACCTGGACCACATCTCGAGATGTGGTCCAGGTTGAACCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262087    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039124.2-751s21c1
Sequence:CCGGCTCCTTCAAGCTGGACGATGTCTCGAGACATCGTCCAGCTTGAAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039124.2-599s21c1
Sequence:CCGGGGAGGGAAGATCTAGCAACAACTCGAGTTGTTGCTAGATCTTCCCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039124
KNCN MISSION shRNA shRNA Plasmid DNA
kinocilin
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039124.2-565s21c1
Sequence:CCGGTGAGAATCCATCCTAACTCAGCTCGAGCTGAGTTAGGATGGATTCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039124.2-449s21c1
Sequence:CCGGTGCTGCTGTGGGTGGTATCTTCTCGAGAAGATACCACCCACAGCAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039124.2-524s21c1
Sequence:CCGGTCGGTTCAACCTGGACCACATCTCGAGATGTGGTCCAGGTTGAACCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262087    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039124.2-751s21c1
Sequence:CCGGCTCCTTCAAGCTGGACGATGTCTCGAGACATCGTCCAGCTTGAAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039124.2-599s21c1
Sequence:CCGGGGAGGGAAGATCTAGCAACAACTCGAGTTGTTGCTAGATCTTCCCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039124
KNCN MISSION shRNA Lentiviral Transduction Particles
kinocilin
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039124.2-565s21c1
Sequence:CCGGTGAGAATCCATCCTAACTCAGCTCGAGCTGAGTTAGGATGGATTCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039124.2-449s21c1
Sequence:CCGGTGCTGCTGTGGGTGGTATCTTCTCGAGAAGATACCACCCACAGCAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039124.2-524s21c1
Sequence:CCGGTCGGTTCAACCTGGACCACATCTCGAGATGTGGTCCAGGTTGAACCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262087    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039124.2-751s21c1
Sequence:CCGGCTCCTTCAAGCTGGACGATGTCTCGAGACATCGTCCAGCTTGAAGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039124.2-599s21c1
Sequence:CCGGGGAGGGAAGATCTAGCAACAACTCGAGTTGTTGCTAGATCTTCCCTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001097611
KNCN MISSION shRNA Bacterial Glycerol Stock
kinocilin
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000242539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097611.1-66s21c1
Sequence:CCGGGGTGGCTGGCAGCATCATTATCTCGAGATAATGATGCTGCCAGCCACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097611.1-117s21c1
Sequence:CCGGCATGGGCGGTGTCTTTATTGGCTCGAGCCAATAAAGACACCGCCCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097611.1-294s21c1
Sequence:CCGGTGAGGAATGCTGAGGCAAAGTCTCGAGACTTTGCCTCAGCATTCCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242537    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001097611.1-1305s21c1
Sequence:CCGGACCAGACCAGTAGGTGCTTAACTCGAGTTAAGCACCTACTGGTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097611.1-200s21c1
Sequence:CCGGGATCCAGCACCAATGGCAACACTCGAGTGTTGCCATTGGTGCTGGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001097611
KNCN MISSION shRNA shRNA Plasmid DNA
kinocilin
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000242539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097611.1-66s21c1
Sequence:CCGGGGTGGCTGGCAGCATCATTATCTCGAGATAATGATGCTGCCAGCCACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097611.1-117s21c1
Sequence:CCGGCATGGGCGGTGTCTTTATTGGCTCGAGCCAATAAAGACACCGCCCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097611.1-294s21c1
Sequence:CCGGTGAGGAATGCTGAGGCAAAGTCTCGAGACTTTGCCTCAGCATTCCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242537    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001097611.1-1305s21c1
Sequence:CCGGACCAGACCAGTAGGTGCTTAACTCGAGTTAAGCACCTACTGGTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097611.1-200s21c1
Sequence:CCGGGATCCAGCACCAATGGCAACACTCGAGTGTTGCCATTGGTGCTGGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001097611
KNCN MISSION shRNA Lentiviral Transduction Particles
kinocilin
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000242539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097611.1-66s21c1
Sequence:CCGGGGTGGCTGGCAGCATCATTATCTCGAGATAATGATGCTGCCAGCCACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097611.1-117s21c1
Sequence:CCGGCATGGGCGGTGTCTTTATTGGCTCGAGCCAATAAAGACACCGCCCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097611.1-294s21c1
Sequence:CCGGTGAGGAATGCTGAGGCAAAGTCTCGAGACTTTGCCTCAGCATTCCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242537    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001097611.1-1305s21c1
Sequence:CCGGACCAGACCAGTAGGTGCTTAACTCGAGTTAAGCACCTACTGGTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097611.1-200s21c1
Sequence:CCGGGATCCAGCACCAATGGCAACACTCGAGTGTTGCCATTGGTGCTGGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)