EMAIL THIS PAGE TO A FRIEND

KNDC1

kinase non-catalytic C-lobe domain (KIND) containing 1

82 Gene Product Result for
Synonyms: C10orf23 RASGEF2 bB439H18.3
Gene ID:
Mouse(76484) kinase non-catalytic C-lobe domain (KIND) containing 1
Rat(361672) kinase non-catalytic C-lobe domain (KIND) containing 1
domestic guinea pig(100729321) kinase non-catalytic C-lobe domain (KIND) containing 1
naked mole-rat(101702698) kinase non-catalytic C-lobe domain (KIND) containing 1
sheep(101110807) kinase non-catalytic C-lobe domain (KIND) containing 1
chicken(423824) kinase non-catalytic C-lobe domain (KIND) containing 1
dog(491411) kinase non-catalytic C-lobe domain (KIND) containing 1
domestic cat(101088364) kinase non-catalytic C-lobe domain (KIND) containing 1
Horse(100050566) kinase non-catalytic C-lobe domain (KIND) containing 1
cow(536342) kinase non-catalytic C-lobe domain (KIND) containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177261 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177261 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177261 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_133920 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_133920 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_133920 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152643 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152643 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152643 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_033404 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033404 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033404 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033404 Rosetta Predictions human pricing
NM_152643 Rosetta Predictions human pricing
XM_341956 Rosetta Predictions rat pricing
XR_007695 Rosetta Predictions rat pricing
NM_177261 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033404 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00245552 predicted 990
2 SASI_Hs01_00245553 predicted 1765
3 SASI_Hs01_00245554 predicted 1436
4 SASI_Hs01_00245555 predicted 2759
5 SASI_Hs01_00245556 predicted 1728
6 SASI_Hs01_00245557 predicted 388
7 SASI_Hs01_00245558 predicted 2777
8 SASI_Hs01_00245559 predicted 3192
9 SASI_Hs01_00245560 predicted 2712
10 SASI_Hs01_00245561 predicted 1663
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152643 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00366531 predicted 4374
2 SASI_Hs02_00366532 predicted 4572
3 SASI_Hs02_00366533 predicted 348
4 SASI_Hs02_00366534 predicted 4185
5 SASI_Hs02_00366535 predicted 4644
6 SASI_Hs02_00366536 predicted 4560
7 SASI_Hs02_00366537 predicted 3507
8 SASI_Hs02_00366538 predicted 3543
9 SASI_Hs02_00366539 predicted 4721
10 SASI_Hs02_00366540 predicted 5147
11 SASI_Hs01_00018064 predicted 997
12 SASI_Hs01_00018065 predicted 1765
13 SASI_Hs01_00018066 predicted 1439
14 SASI_Hs01_00018067 predicted 2764
15 SASI_Hs01_00018068 predicted 1728
16 SASI_Hs01_00018069 predicted 386
17 SASI_Hs01_00018070 predicted 2774
18 SASI_Hs01_00018071 predicted 3190
19 SASI_Hs01_00018072 predicted 2711
20 SASI_Hs01_00018073 predicted 1663
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341956 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00164230 predicted 602
2 SASI_Rn01_00164231 predicted 1092
3 SASI_Rn01_00164232 predicted 591
4 SASI_Rn01_00164233 predicted 1020
5 SASI_Rn01_00164234 predicted 702
6 SASI_Rn01_00164235 predicted 680
7 SASI_Rn01_00164236 predicted 878
8 SASI_Rn01_00164237 predicted 962
9 SASI_Rn01_00164238 predicted 920
10 SASI_Rn01_00164239 predicted 418
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_007695 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00131354 predicted 4811
2 SASI_Rn01_00131355 predicted 6447
3 SASI_Rn02_00415227 predicted 2664
4 SASI_Rn01_00131357 predicted 6067
5 SASI_Rn01_00131359 predicted 6018
6 SASI_Rn01_00131360 predicted 5003
7 SASI_Rn01_00131362 predicted 6630
8 SASI_Rn02_00415228 predicted 3210
9 SASI_Rn02_00415229 predicted 3497
10 SASI_Rn02_00415230 predicted 3528
11 SASI_Rn01_00131353 predicted 5091
12 SASI_Rn01_00131356 predicted 4724
13 SASI_Rn01_00131358 predicted 6647
14 SASI_Rn01_00131361 predicted 4830
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177261 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00077708 predicted 4836
2 SASI_Mm01_00077709 predicted 5434
3 SASI_Mm02_00347300 predicted 4740
4 SASI_Mm01_00077710 predicted 5120
5 SASI_Mm01_00077711 predicted 5459
6 SASI_Mm02_00347301 predicted 1161
7 SASI_Mm02_00347302 predicted 5044
8 SASI_Mm02_00347303 predicted 5147
9 SASI_Mm01_00077713 predicted 1486
10 SASI_Mm01_00077714 predicted 5163
11 SASI_Mm01_00077712 predicted 4070
12 SASI_Mm01_00077715 predicted 3387
13 SASI_Mm01_00077716 predicted 1685
14 SASI_Mm01_00077717 predicted 3609
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177261
KNDC1 MISSION shRNA Bacterial Glycerol Stock
kinase non-catalytic C-lobe domain (KIND) containing 1
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000378441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177261.4-4740s21c1
Sequence:CCGGCTAGTGCTGCCACATCATAAGCTCGAGCTTATGATGTGGCAGCACTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177261.4-3551s21c1
Sequence:CCGGTCGGTCTCAGAAGTCAATAAACTCGAGTTTATTGACTTCTGAGACCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177261.4-5278s21c1
Sequence:CCGGGAATCCTGCCTGCGAAGATTGCTCGAGCAATCTTCGCAGGCAGGATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177261
KNDC1 MISSION shRNA shRNA Plasmid DNA
kinase non-catalytic C-lobe domain (KIND) containing 1
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000378441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177261.4-4740s21c1
Sequence:CCGGCTAGTGCTGCCACATCATAAGCTCGAGCTTATGATGTGGCAGCACTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177261.4-3551s21c1
Sequence:CCGGTCGGTCTCAGAAGTCAATAAACTCGAGTTTATTGACTTCTGAGACCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177261.4-5278s21c1
Sequence:CCGGGAATCCTGCCTGCGAAGATTGCTCGAGCAATCTTCGCAGGCAGGATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177261
KNDC1 MISSION shRNA Lentiviral Transduction Particles
kinase non-catalytic C-lobe domain (KIND) containing 1
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000378441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177261.4-4740s21c1
Sequence:CCGGCTAGTGCTGCCACATCATAAGCTCGAGCTTATGATGTGGCAGCACTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177261.4-3551s21c1
Sequence:CCGGTCGGTCTCAGAAGTCAATAAACTCGAGTTTATTGACTTCTGAGACCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177261.4-5278s21c1
Sequence:CCGGGAATCCTGCCTGCGAAGATTGCTCGAGCAATCTTCGCAGGCAGGATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_133920
KNDC1 MISSION shRNA Bacterial Glycerol Stock
kinase non-catalytic C-lobe domain (KIND) containing 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000088663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133920.4-747s1c1
Sequence:CCGGGACCATGATGATGGGAGACTACTCGAGTAGTCTCCCATCATCATGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133920.4-3015s1c1
Sequence:CCGGTGAGAAGTTCTGTGACCTATACTCGAGTATAGGTCACAGAACTTCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133920.4-4870s1c1
Sequence:CCGGGCTGAAATTGTGACCAGTCATCTCGAGATGACTGGTCACAATTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133920.4-153s1c1
Sequence:CCGGGCAGGATAACTCTGTCTATAACTCGAGTTATAGACAGAGTTATCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133920.4-4945s1c1
Sequence:CCGGTGCTACGAACAGAGGAACTTTCTCGAGAAAGTTCCTCTGTTCGTAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_133920
KNDC1 MISSION shRNA shRNA Plasmid DNA
kinase non-catalytic C-lobe domain (KIND) containing 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000088663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133920.4-747s1c1
Sequence:CCGGGACCATGATGATGGGAGACTACTCGAGTAGTCTCCCATCATCATGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133920.4-3015s1c1
Sequence:CCGGTGAGAAGTTCTGTGACCTATACTCGAGTATAGGTCACAGAACTTCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133920.4-4870s1c1
Sequence:CCGGGCTGAAATTGTGACCAGTCATCTCGAGATGACTGGTCACAATTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133920.4-153s1c1
Sequence:CCGGGCAGGATAACTCTGTCTATAACTCGAGTTATAGACAGAGTTATCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133920.4-4945s1c1
Sequence:CCGGTGCTACGAACAGAGGAACTTTCTCGAGAAAGTTCCTCTGTTCGTAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_133920
KNDC1 MISSION shRNA Lentiviral Transduction Particles
kinase non-catalytic C-lobe domain (KIND) containing 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000088663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133920.4-747s1c1
Sequence:CCGGGACCATGATGATGGGAGACTACTCGAGTAGTCTCCCATCATCATGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133920.4-3015s1c1
Sequence:CCGGTGAGAAGTTCTGTGACCTATACTCGAGTATAGGTCACAGAACTTCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133920.4-4870s1c1
Sequence:CCGGGCTGAAATTGTGACCAGTCATCTCGAGATGACTGGTCACAATTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133920.4-153s1c1
Sequence:CCGGGCAGGATAACTCTGTCTATAACTCGAGTTATAGACAGAGTTATCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133920.4-4945s1c1
Sequence:CCGGTGCTACGAACAGAGGAACTTTCTCGAGAAAGTTCCTCTGTTCGTAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152643
VALIDATED
KNDC1 MISSION shRNA Bacterial Glycerol Stock
kinase non-catalytic C-lobe domain (KIND) containing 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152643.4-4530s1c1
Sequence:CCGGCCAGCTCTTCTGAGTCTCTTTCTCGAGAAAGAGACTCAGAAGAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152643.4-4563s1c1
Sequence:CCGGGCAGCTTATTTCTGCCAAATTCTCGAGAATTTGGCAGAAATAAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152643.4-4682s1c1
Sequence:CCGGCAGGTGAACTTGCTGTCCAAACTCGAGTTTGGACAGCAAGTTCACCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_152643.4-3820s1c1
Sequence:CCGGGCAGCAATTCCTCTACACCTTCTCGAGAAGGTGTAGAGGAATTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152643.4-5204s1c1
Sequence:CCGGCGGAAGATTCAGGACAAGCTACTCGAGTAGCTTGTCCTGAATCTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152643
VALIDATED
KNDC1 MISSION shRNA shRNA Plasmid DNA
kinase non-catalytic C-lobe domain (KIND) containing 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152643.4-4530s1c1
Sequence:CCGGCCAGCTCTTCTGAGTCTCTTTCTCGAGAAAGAGACTCAGAAGAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152643.4-4563s1c1
Sequence:CCGGGCAGCTTATTTCTGCCAAATTCTCGAGAATTTGGCAGAAATAAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152643.4-4682s1c1
Sequence:CCGGCAGGTGAACTTGCTGTCCAAACTCGAGTTTGGACAGCAAGTTCACCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_152643.4-3820s1c1
Sequence:CCGGGCAGCAATTCCTCTACACCTTCTCGAGAAGGTGTAGAGGAATTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152643.4-5204s1c1
Sequence:CCGGCGGAAGATTCAGGACAAGCTACTCGAGTAGCTTGTCCTGAATCTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152643
VALIDATED
KNDC1 MISSION shRNA Lentiviral Transduction Particles
kinase non-catalytic C-lobe domain (KIND) containing 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152643.4-4530s1c1
Sequence:CCGGCCAGCTCTTCTGAGTCTCTTTCTCGAGAAAGAGACTCAGAAGAGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152643.4-4563s1c1
Sequence:CCGGGCAGCTTATTTCTGCCAAATTCTCGAGAATTTGGCAGAAATAAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152643.4-4682s1c1
Sequence:CCGGCAGGTGAACTTGCTGTCCAAACTCGAGTTTGGACAGCAAGTTCACCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_152643.4-3820s1c1
Sequence:CCGGGCAGCAATTCCTCTACACCTTCTCGAGAAGGTGTAGAGGAATTGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152643.4-5204s1c1
Sequence:CCGGCGGAAGATTCAGGACAAGCTACTCGAGTAGCTTGTCCTGAATCTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033404
VALIDATED
KNDC1 MISSION shRNA Bacterial Glycerol Stock
kinase non-catalytic C-lobe domain (KIND) containing 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033404.2-991s1c1
Sequence:CCGGGCTGCCCATATCGGAATTATTCTCGAGAATAATTCCGATATGGGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033404.2-2860s1c1
Sequence:CCGGGAACCTCTTTAAGGTGGTCAACTCGAGTTGACCACCTTAAAGAGGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_033404.2-3547s1c1
Sequence:CCGGGCAATTCCTCAGCTTGGTCAACTCGAGTTGACCAAGCTGAGGAATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_033404.2-1513s1c1
Sequence:CCGGCGGTTCCTATGACTCGTTCTTCTCGAGAAGAACGAGTCATAGGAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033404.2-2774s1c1
Sequence:CCGGGCCTTGAAAGATCTCACCTTTCTCGAGAAAGGTGAGATCTTTCAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033404
VALIDATED
KNDC1 MISSION shRNA shRNA Plasmid DNA
kinase non-catalytic C-lobe domain (KIND) containing 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033404.2-991s1c1
Sequence:CCGGGCTGCCCATATCGGAATTATTCTCGAGAATAATTCCGATATGGGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033404.2-2860s1c1
Sequence:CCGGGAACCTCTTTAAGGTGGTCAACTCGAGTTGACCACCTTAAAGAGGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_033404.2-3547s1c1
Sequence:CCGGGCAATTCCTCAGCTTGGTCAACTCGAGTTGACCAAGCTGAGGAATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_033404.2-1513s1c1
Sequence:CCGGCGGTTCCTATGACTCGTTCTTCTCGAGAAGAACGAGTCATAGGAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033404.2-2774s1c1
Sequence:CCGGGCCTTGAAAGATCTCACCTTTCTCGAGAAAGGTGAGATCTTTCAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033404
VALIDATED
KNDC1 MISSION shRNA Lentiviral Transduction Particles
kinase non-catalytic C-lobe domain (KIND) containing 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033404.2-991s1c1
Sequence:CCGGGCTGCCCATATCGGAATTATTCTCGAGAATAATTCCGATATGGGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033404.2-2860s1c1
Sequence:CCGGGAACCTCTTTAAGGTGGTCAACTCGAGTTGACCACCTTAAAGAGGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_033404.2-3547s1c1
Sequence:CCGGGCAATTCCTCAGCTTGGTCAACTCGAGTTGACCAAGCTGAGGAATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_033404.2-1513s1c1
Sequence:CCGGCGGTTCCTATGACTCGTTCTTCTCGAGAAGAACGAGTCATAGGAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033404.2-2774s1c1
Sequence:CCGGGCCTTGAAAGATCTCACCTTTCTCGAGAAAGGTGAGATCTTTCAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)