EMAIL THIS PAGE TO A FRIEND

KNG1

kininogen 1

117 Gene Product Result for
Synonyms: BDK BK KNG
Gene ID:
Human(3827) Summary: This gene uses alternative splicing to generate two different proteins- high molecular weight kininogen (HMWK) and low molecular weight kininogen (LMWK). HMWK is essential for blood coagulation and assembly of the kallikrein-kinin system. Also, bradykinin, a peptide causing numerous physiological effects, is released from HMWK. In contrast to HMWK, LMWK is not involved in blood coagulation. Three transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Oct 2009]
Mouse(16644) kininogen 1
Rat(24903) kininogen 1
Zebrafish(449808) kininogen 1
chicken(424957) kininogen 1
cow(280833) kininogen 1
Horse(100068133) kininogen 1
dog(478666) kininogen 1
sheep(101112781) kininogen 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0526 AQUA Peptide YFIDFVA[R] human pricing
AQ0527 AQUA Peptide QVVAGLNF[R] human, mouse pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023125 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023125 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023125 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000893 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000893 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000893 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU090921 MISSION® esiRNA esiRNA human KNG1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000893 Rosetta Predictions human pricing
NM_001102416 Rosetta Predictions human pricing
NM_012696 Rosetta Predictions rat pricing
NM_001102411 Rosetta Predictions mouse pricing
NM_001102412 Rosetta Predictions mouse pricing
NM_023125 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000893 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00084349 predicted 906
2 SASI_Hs02_00303449 predicted 1080
3 SASI_Hs02_00303450 predicted 266
4 SASI_Hs01_00084351 predicted 919
5 SASI_Hs02_00303451 predicted 822
6 SASI_Hs01_00084352 predicted 647
7 SASI_Hs01_00084354 predicted 930
8 SASI_Hs01_00084355 predicted 779
9 SASI_Hs01_00084356 predicted 1063
10 SASI_Hs02_00303452 predicted 736
11 SASI_Hs01_00084350 predicted 1423
12 SASI_Hs01_00084353 predicted 1336
13 SASI_Hs01_00084357 predicted 805
14 SASI_Hs01_00084358 predicted 1252
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001102416 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00323113 predicted 910
2 SASI_Hs02_00323114 predicted 1082
3 SASI_Hs02_00323115 predicted 261
4 SASI_Hs02_00323116 predicted 919
5 SASI_Hs02_00323117 predicted 814
6 SASI_Hs02_00323118 predicted 649
7 SASI_Hs02_00323119 predicted 926
8 SASI_Hs02_00323120 predicted 778
9 SASI_Hs02_00323121 predicted 1062
10 SASI_Hs02_00323122 predicted 739
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012696 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00078325 predicted 431
2 SASI_Rn01_00078326 predicted 447
3 SASI_Rn01_00078332 predicted 445
4 SASI_Rn01_00078328 predicted 1370
5 SASI_Rn01_00078329 predicted 1175
6 SASI_Rn01_00078331 predicted 320
7 SASI_Rn01_00078333 predicted 303
8 SASI_Rn01_00078327 predicted 638
9 SASI_Rn01_00078334 predicted 1416
10 SASI_Rn02_00260008 predicted 1597
11 SASI_Rn01_00078330 predicted 349
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001102411 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00302733 predicted 309
2 SASI_Mm02_00302734 predicted 834
3 SASI_Mm02_00302735 predicted 826
4 SASI_Mm02_00302736 predicted 824
5 SASI_Mm02_00302737 predicted 886
6 SASI_Mm02_00302738 predicted 885
7 SASI_Mm02_00302739 predicted 818
8 SASI_Mm02_00302740 predicted 884
9 SASI_Mm02_00302741 predicted 580
10 SASI_Mm02_00302742 predicted 249
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001102412 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00302743 predicted 311
2 SASI_Mm02_00302744 predicted 831
3 SASI_Mm02_00302745 predicted 830
4 SASI_Mm02_00302746 predicted 829
5 SASI_Mm02_00302747 predicted 881
6 SASI_Mm02_00302748 predicted 878
7 SASI_Mm02_00302749 predicted 821
8 SASI_Mm02_00302750 predicted 883
9 SASI_Mm02_00302751 predicted 584
10 SASI_Mm02_00302752 predicted 254
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023125 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00326819 predicted 309
2 SASI_Mm01_00059726 predicted 837
3 SASI_Mm02_00326820 predicted 830
4 SASI_Mm02_00326821 predicted 822
5 SASI_Mm02_00326822 predicted 887
6 SASI_Mm01_00059728 predicted 878
7 SASI_Mm01_00059729 predicted 821
8 SASI_Mm01_00059731 predicted 886
9 SASI_Mm01_00059733 predicted 583
10 SASI_Mm02_00326823 predicted 253
11 SASI_Mm01_00059727 predicted 1204
12 SASI_Mm01_00059730 predicted 1233
13 SASI_Mm01_00059732 predicted 1206
14 SASI_Mm01_00059734 predicted 315
15 SASI_Mm01_00059735 predicted 1370
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023125
KNG1 MISSION shRNA Bacterial Glycerol Stock
kininogen 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000080263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023125.2-514s1c1
Sequence:CCGGCCCTGTATTGGTTGTGTGCATCTCGAGATGCACACAACCAATACAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023125.2-163s1c1
Sequence:CCGGGCGCAGGAAATTGACTGCAATCTCGAGATTGCAGTCAATTTCCTGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023125.2-768s1c1
Sequence:CCGGTGATGGTGAATGTAGAGGAAACTCGAGTTTCCTCTACATTCACCATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023125.2-1204s1c1
Sequence:CCGGCAAGCATTAGATATGACTGAACTCGAGTTCAGTCATATCTAATGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023125.2-782s1c1
Sequence:CCGGGAGGAAATCTCTTCATGGATACTCGAGTATCCATGAAGAGATTTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023125
KNG1 MISSION shRNA shRNA Plasmid DNA
kininogen 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000080263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023125.2-514s1c1
Sequence:CCGGCCCTGTATTGGTTGTGTGCATCTCGAGATGCACACAACCAATACAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023125.2-163s1c1
Sequence:CCGGGCGCAGGAAATTGACTGCAATCTCGAGATTGCAGTCAATTTCCTGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023125.2-768s1c1
Sequence:CCGGTGATGGTGAATGTAGAGGAAACTCGAGTTTCCTCTACATTCACCATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023125.2-1204s1c1
Sequence:CCGGCAAGCATTAGATATGACTGAACTCGAGTTCAGTCATATCTAATGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023125.2-782s1c1
Sequence:CCGGGAGGAAATCTCTTCATGGATACTCGAGTATCCATGAAGAGATTTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023125
KNG1 MISSION shRNA Lentiviral Transduction Particles
kininogen 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000080263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023125.2-514s1c1
Sequence:CCGGCCCTGTATTGGTTGTGTGCATCTCGAGATGCACACAACCAATACAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023125.2-163s1c1
Sequence:CCGGGCGCAGGAAATTGACTGCAATCTCGAGATTGCAGTCAATTTCCTGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023125.2-768s1c1
Sequence:CCGGTGATGGTGAATGTAGAGGAAACTCGAGTTTCCTCTACATTCACCATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023125.2-1204s1c1
Sequence:CCGGCAAGCATTAGATATGACTGAACTCGAGTTCAGTCATATCTAATGCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023125.2-782s1c1
Sequence:CCGGGAGGAAATCTCTTCATGGATACTCGAGTATCCATGAAGAGATTTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000893
KNG1 MISSION shRNA Bacterial Glycerol Stock
kininogen 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000893.2-244s1c1
Sequence:CCGGCCAGGCTGCTACTAAGTTTAACTCGAGTTAAACTTAGTAGCAGCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073603    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000893.2-1507s1c1
Sequence:CCGGGAATCTTCACTCCAGGCACATCTCGAGATGTGCCTGGAGTGAAGATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000893.2-783s1c1
Sequence:CCGGGCTGGATTGAACTTTCGAATTCTCGAGAATTCGAAAGTTCAATCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000893.2-368s1c1
Sequence:CCGGCCAGTTTGTATTGTACCGCATCTCGAGATGCGGTACAATACAAACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000893.2-1015s1c1
Sequence:CCGGCCAGAGATATACCCACCAACACTCGAGTGTTGGTGGGTATATCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000893
KNG1 MISSION shRNA shRNA Plasmid DNA
kininogen 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000893.2-244s1c1
Sequence:CCGGCCAGGCTGCTACTAAGTTTAACTCGAGTTAAACTTAGTAGCAGCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073603    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000893.2-1507s1c1
Sequence:CCGGGAATCTTCACTCCAGGCACATCTCGAGATGTGCCTGGAGTGAAGATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000893.2-783s1c1
Sequence:CCGGGCTGGATTGAACTTTCGAATTCTCGAGAATTCGAAAGTTCAATCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000893.2-368s1c1
Sequence:CCGGCCAGTTTGTATTGTACCGCATCTCGAGATGCGGTACAATACAAACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000893.2-1015s1c1
Sequence:CCGGCCAGAGATATACCCACCAACACTCGAGTGTTGGTGGGTATATCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000893
KNG1 MISSION shRNA Lentiviral Transduction Particles
kininogen 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000893.2-244s1c1
Sequence:CCGGCCAGGCTGCTACTAAGTTTAACTCGAGTTAAACTTAGTAGCAGCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073603    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000893.2-1507s1c1
Sequence:CCGGGAATCTTCACTCCAGGCACATCTCGAGATGTGCCTGGAGTGAAGATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000893.2-783s1c1
Sequence:CCGGGCTGGATTGAACTTTCGAATTCTCGAGAATTCGAAAGTTCAATCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000893.2-368s1c1
Sequence:CCGGCCAGTTTGTATTGTACCGCATCTCGAGATGCGGTACAATACAAACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000893.2-1015s1c1
Sequence:CCGGCCAGAGATATACCCACCAACACTCGAGTGTTGGTGGGTATATCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)