EMAIL THIS PAGE TO A FRIEND

KNOP1

lysine-rich nucleolar protein 1

58 Gene Product Result for
Synonyms: 101F10.1 C16orf88 FAM191A TSG118
UniProtKB ID: Q1ED39, O43328, Q5FWF3
Gene ID:
Mouse(66356) lysine rich nucleolar protein 1
Rat(499255) lysine-rich nucleolar protein 1
Zebrafish(558776) lysine-rich nucleolar protein 1
cow(511442) chromosome 25 open reading frame, human C16orf88
domestic guinea pig(100731612) lysine-rich nucleolar protein 1
naked mole-rat(101706671) lysine-rich nucleolar protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023197 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023197 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023197 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001012991 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001012991 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001012991 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012991 Rosetta Predictions human pricing
NM_001134611 Rosetta Predictions rat pricing
NM_023197 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012991 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00306304 predicted 1194
2 SASI_Hs02_00306305 predicted 1207
3 SASI_Hs02_00306306 predicted 1191
4 SASI_Hs02_00306307 predicted 1205
5 SASI_Hs02_00306308 predicted 1211
6 SASI_Hs02_00306309 predicted 789
7 SASI_Hs02_00306310 predicted 1367
8 SASI_Hs02_00306311 predicted 83
9 SASI_Hs02_00306312 predicted 241
10 SASI_Hs02_00306313 predicted 796
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134611 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00257589 predicted 1308
2 SASI_Rn02_00257590 predicted 506
3 SASI_Rn02_00257591 predicted 1954
4 SASI_Rn02_00257592 predicted 1169
5 SASI_Rn02_00257593 predicted 657
6 SASI_Rn02_00257594 predicted 1277
7 SASI_Rn02_00257595 predicted 830
8 SASI_Rn02_00257596 predicted 1601
9 SASI_Rn02_00257597 predicted 646
10 SASI_Rn02_00257598 predicted 668
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023197 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00201321 predicted 1848
2 SASI_Mm02_00326927 predicted 2455
3 SASI_Mm02_00326928 predicted 2406
4 SASI_Mm02_00326929 predicted 2086
5 SASI_Mm02_00326930 predicted 2360
6 SASI_Mm02_00326931 predicted 2512
7 SASI_Mm02_00326932 predicted 2203
8 SASI_Mm02_00326933 predicted 2146
9 SASI_Mm02_00326934 predicted 1980
10 SASI_Mm02_00326935 predicted 2252
11 SASI_Mm01_00201316 predicted 1687
12 SASI_Mm01_00201317 predicted 1666
13 SASI_Mm01_00201318 predicted 1776
14 SASI_Mm01_00201319 predicted 1638
15 SASI_Mm01_00201320 predicted 1694
16 SASI_Mm01_00201322 predicted 1774
17 SASI_Mm01_00201323 predicted 1740
18 SASI_Mm01_00201324 predicted 1741
19 SASI_Mm01_00201325 predicted 1774
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023197
VALIDATED
KNOP1 MISSION shRNA Bacterial Glycerol Stock
lysine-rich nucleolar protein 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000264656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023197.2-2102s21c1
Sequence:CCGGCCCGAAAGGTCTTCTACATTGCTCGAGCAATGTAGAAGACCTTTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023197.2-2141s21c1
Sequence:CCGGCTATCAAGTTGCAAGATTAAACTCGAGTTTAATCTTGCAACTTGATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023197.2-700s21c1
Sequence:CCGGCCTGCTAGCGAACCAGTAATGCTCGAGCATTACTGGTTCGCTAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264655    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023197.2-4910s21c1
Sequence:CCGGGTAACGTACAAAGGATTATTTCTCGAGAAATAATCCTTTGTACGTTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216296    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023197.2-4910s1c1
Sequence:CCGGGTAACGTACAAAGGATTATTTCTCGAGAAATAATCCTTTGTACGTTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023197.1-648s1c1
Sequence:CCGGGAGACTCAATACTCAGTCTTACTCGAGTAAGACTGAGTATTGAGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023197.2-2141s1c1
Sequence:CCGGCTATCAAGTTGCAAGATTAAACTCGAGTTTAATCTTGCAACTTGATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023197.2-1605s21c1
Sequence:CCGGGAGGAAAGAGAACGGAGTAAACTCGAGTTTACTCCGTTCTCTTTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023197
VALIDATED
KNOP1 MISSION shRNA shRNA Plasmid DNA
lysine-rich nucleolar protein 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000264656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023197.2-2102s21c1
Sequence:CCGGCCCGAAAGGTCTTCTACATTGCTCGAGCAATGTAGAAGACCTTTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023197.2-2141s21c1
Sequence:CCGGCTATCAAGTTGCAAGATTAAACTCGAGTTTAATCTTGCAACTTGATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023197.2-700s21c1
Sequence:CCGGCCTGCTAGCGAACCAGTAATGCTCGAGCATTACTGGTTCGCTAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264655    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023197.2-4910s21c1
Sequence:CCGGGTAACGTACAAAGGATTATTTCTCGAGAAATAATCCTTTGTACGTTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216296    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023197.2-4910s1c1
Sequence:CCGGGTAACGTACAAAGGATTATTTCTCGAGAAATAATCCTTTGTACGTTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023197.1-648s1c1
Sequence:CCGGGAGACTCAATACTCAGTCTTACTCGAGTAAGACTGAGTATTGAGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023197.2-2141s1c1
Sequence:CCGGCTATCAAGTTGCAAGATTAAACTCGAGTTTAATCTTGCAACTTGATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023197.2-1605s21c1
Sequence:CCGGGAGGAAAGAGAACGGAGTAAACTCGAGTTTACTCCGTTCTCTTTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023197
VALIDATED
KNOP1 MISSION shRNA Lentiviral Transduction Particles
lysine-rich nucleolar protein 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000264656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023197.2-2102s21c1
Sequence:CCGGCCCGAAAGGTCTTCTACATTGCTCGAGCAATGTAGAAGACCTTTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023197.2-2141s21c1
Sequence:CCGGCTATCAAGTTGCAAGATTAAACTCGAGTTTAATCTTGCAACTTGATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023197.2-700s21c1
Sequence:CCGGCCTGCTAGCGAACCAGTAATGCTCGAGCATTACTGGTTCGCTAGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264655    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023197.2-4910s21c1
Sequence:CCGGGTAACGTACAAAGGATTATTTCTCGAGAAATAATCCTTTGTACGTTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216296    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023197.2-4910s1c1
Sequence:CCGGGTAACGTACAAAGGATTATTTCTCGAGAAATAATCCTTTGTACGTTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023197.1-648s1c1
Sequence:CCGGGAGACTCAATACTCAGTCTTACTCGAGTAAGACTGAGTATTGAGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023197.2-2141s1c1
Sequence:CCGGCTATCAAGTTGCAAGATTAAACTCGAGTTTAATCTTGCAACTTGATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023197.2-1605s21c1
Sequence:CCGGGAGGAAAGAGAACGGAGTAAACTCGAGTTTACTCCGTTCTCTTTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001012991
VALIDATED
KNOP1 MISSION shRNA Bacterial Glycerol Stock
lysine-rich nucleolar protein 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000264088    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001012991.2-1554s21c1
Sequence:CCGGACTAGGCATAAATGGTTTATTCTCGAGAATAAACCATTTATGCCTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_001012991.2-129s21c1
Sequence:CCGGTGCTGATGTTTCTCCTTTAAGCTCGAGCTTAAAGGAGAAACATCAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_001012991.2-1134s21c1
Sequence:CCGGACTGAAATTTCTCAGACTTATCTCGAGATAAGTCTGAGAAATTTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_001012991.2-784s21c1
Sequence:CCGGCCCATAAGTGATGACCCTAAGCTCGAGCTTAGGGTCATCACTTATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012991.2-1373s21c1
Sequence:CCGGCAGTCAAGCTGGAAGATTAAACTCGAGTTTAATCTTCCAGCTTGACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001012991
VALIDATED
KNOP1 MISSION shRNA shRNA Plasmid DNA
lysine-rich nucleolar protein 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000264088    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001012991.2-1554s21c1
Sequence:CCGGACTAGGCATAAATGGTTTATTCTCGAGAATAAACCATTTATGCCTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_001012991.2-129s21c1
Sequence:CCGGTGCTGATGTTTCTCCTTTAAGCTCGAGCTTAAAGGAGAAACATCAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_001012991.2-1134s21c1
Sequence:CCGGACTGAAATTTCTCAGACTTATCTCGAGATAAGTCTGAGAAATTTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_001012991.2-784s21c1
Sequence:CCGGCCCATAAGTGATGACCCTAAGCTCGAGCTTAGGGTCATCACTTATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012991.2-1373s21c1
Sequence:CCGGCAGTCAAGCTGGAAGATTAAACTCGAGTTTAATCTTCCAGCTTGACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001012991
VALIDATED
KNOP1 MISSION shRNA Lentiviral Transduction Particles
lysine-rich nucleolar protein 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000264088    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001012991.2-1554s21c1
Sequence:CCGGACTAGGCATAAATGGTTTATTCTCGAGAATAAACCATTTATGCCTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_001012991.2-129s21c1
Sequence:CCGGTGCTGATGTTTCTCCTTTAAGCTCGAGCTTAAAGGAGAAACATCAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_001012991.2-1134s21c1
Sequence:CCGGACTGAAATTTCTCAGACTTATCTCGAGATAAGTCTGAGAAATTTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_001012991.2-784s21c1
Sequence:CCGGCCCATAAGTGATGACCCTAAGCTCGAGCTTAGGGTCATCACTTATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012991.2-1373s21c1
Sequence:CCGGCAGTCAAGCTGGAAGATTAAACTCGAGTTTAATCTTCCAGCTTGACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)