EMAIL THIS PAGE TO A FRIEND

KNSTRN

kinetochore-localized astrin/SPAG5 binding protein

91 Gene Product Result for
Synonyms: C15orf23 SKAP TRAF4AF1
Gene ID:
Mouse(51944) kinetochore-localized astrin/SPAG5 binding
Rat(311325) kinetochore-localized astrin/SPAG5 binding protein
domestic guinea pig(100714697) kinetochore-localized astrin/SPAG5 binding protein
naked mole-rat(101710154) kinetochore-localized astrin/SPAG5 binding protein
Zebrafish(792608) kinetochore-localized astrin/SPAG5 binding protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026412 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026412 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026412 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_033286 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033286 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033286 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033286 Rosetta Predictions human pricing
NM_001004264 Rosetta Predictions rat pricing
XM_001080771 Rosetta Predictions rat pricing
NM_026412 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033286 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00076070 predicted 344
2 SASI_Hs02_00361092 predicted 476
3 SASI_Hs01_00076072 predicted 575
4 SASI_Hs02_00361093 predicted 904
5 SASI_Hs02_00361094 predicted 963
6 SASI_Hs01_00076074 predicted 519
7 SASI_Hs01_00076075 predicted 771
8 SASI_Hs02_00361095 predicted 921
9 SASI_Hs01_00076076 predicted 370
10 SASI_Hs02_00361096 predicted 933
11 SASI_Hs01_00076069 predicted 335
12 SASI_Hs01_00076071 predicted 263
13 SASI_Hs01_00076073 predicted 577
14 SASI_Hs01_00076077 predicted 441
15 SASI_Hs01_00076078 predicted 473
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004264 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00074346 predicted 385
2 SASI_Rn01_00074347 predicted 701
3 SASI_Rn01_00074348 predicted 545
4 SASI_Rn01_00074349 predicted 368
5 SASI_Rn01_00074350 predicted 989
6 SASI_Rn01_00074351 predicted 363
7 SASI_Rn02_00198284 predicted 1054
8 SASI_Rn02_00198285 predicted 721
9 SASI_Rn01_00074352 predicted 296
10 SASI_Rn01_00074353 predicted 401
11 SASI_Rn01_00074354 predicted 804
12 SASI_Rn01_00074355 predicted 1211
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080771 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00369292 predicted 1272
2 SASI_Rn02_00369293 predicted 1060
3 SASI_Rn02_00369294 predicted 644
4 SASI_Rn02_00369295 predicted 1237
5 SASI_Rn02_00369296 predicted 1207
6 SASI_Rn02_00369297 predicted 1062
7 SASI_Rn02_00369298 predicted 945
8 SASI_Rn02_00369299 predicted 881
9 SASI_Rn02_00369300 predicted 909
10 SASI_Rn02_00369301 predicted 907
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026412 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00195025 predicted 723
2 SASI_Mm01_00195027 predicted 389
3 SASI_Mm02_00330208 predicted 514
4 SASI_Mm01_00195028 predicted 1088
5 SASI_Mm02_00330209 predicted 410
6 SASI_Mm01_00195029 predicted 324
7 SASI_Mm01_00195030 predicted 435
8 SASI_Mm01_00195031 predicted 336
9 SASI_Mm01_00195032 predicted 980
10 SASI_Mm01_00195033 predicted 1015
11 SASI_Mm01_00195026 predicted 1009
12 SASI_Mm01_00195034 predicted 638
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026412
VALIDATED
KNSTRN MISSION shRNA Bacterial Glycerol Stock
kinetochore-localized astrin/SPAG5 binding protein
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026412.3-246s21c1
Sequence:CCGGGCTGCGGAGCATTATTTGAAACTCGAGTTTCAAATAATGCTCCGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319898    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026412.3-1281s21c1
Sequence:CCGGCCCTTAGAACTAGGATACTAACTCGAGTTAGTATCCTAGTTCTAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026412.1-247s1c1
Sequence:CCGGGCTGCGGAGCATTATTTGAAACTCGAGTTTCAAATAATGCTCCGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026412.1-968s1c1
Sequence:CCGGCCTTATGTAAGGACGAAGCCACTCGAGTGGCTTCGTCCTTACATAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026412.2-990s1c1
Sequence:CCGGGACTTCACAATAATCCTAGAGCTCGAGCTCTAGGATTATTGTGAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026412.3-414s21c1
Sequence:CCGGGCTACTTCTAAACTACCTGTTCTCGAGAACAGGTAGTTTAGAAGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026412.3-967s21c1
Sequence:CCGGCCTTATGTAAGGACGAAGCCACTCGAGTGGCTTCGTCCTTACATAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191181    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026412.1-1282s1c1
Sequence:CCGGCCCTTAGAACTAGGATACTAACTCGAGTTAGTATCCTAGTTCTAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026412.1-838s1c1
Sequence:CCGGCTCGAAACTTTGAAAGACGAACTCGAGTTCGTCTTTCAAAGTTTCGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026412.1-415s1c1
Sequence:CCGGGCTACTTCTAAACTACCTGTTCTCGAGAACAGGTAGTTTAGAAGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026412.2-447s1c1
Sequence:CCGGGCGGATTTGCTTAGACATCTTCTCGAGAAGATGTCTAAGCAAATCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200545    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026412.1-1283s1c1
Sequence:CCGGCCTTAGAACTAGGATACTAAACTCGAGTTTAGTATCCTAGTTCTAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026412
VALIDATED
KNSTRN MISSION shRNA shRNA Plasmid DNA
kinetochore-localized astrin/SPAG5 binding protein
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026412.3-246s21c1
Sequence:CCGGGCTGCGGAGCATTATTTGAAACTCGAGTTTCAAATAATGCTCCGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319898    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026412.3-1281s21c1
Sequence:CCGGCCCTTAGAACTAGGATACTAACTCGAGTTAGTATCCTAGTTCTAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026412.1-247s1c1
Sequence:CCGGGCTGCGGAGCATTATTTGAAACTCGAGTTTCAAATAATGCTCCGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026412.1-968s1c1
Sequence:CCGGCCTTATGTAAGGACGAAGCCACTCGAGTGGCTTCGTCCTTACATAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026412.2-990s1c1
Sequence:CCGGGACTTCACAATAATCCTAGAGCTCGAGCTCTAGGATTATTGTGAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026412.3-414s21c1
Sequence:CCGGGCTACTTCTAAACTACCTGTTCTCGAGAACAGGTAGTTTAGAAGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026412.3-967s21c1
Sequence:CCGGCCTTATGTAAGGACGAAGCCACTCGAGTGGCTTCGTCCTTACATAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191181    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026412.1-1282s1c1
Sequence:CCGGCCCTTAGAACTAGGATACTAACTCGAGTTAGTATCCTAGTTCTAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026412.1-838s1c1
Sequence:CCGGCTCGAAACTTTGAAAGACGAACTCGAGTTCGTCTTTCAAAGTTTCGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026412.1-415s1c1
Sequence:CCGGGCTACTTCTAAACTACCTGTTCTCGAGAACAGGTAGTTTAGAAGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026412.2-447s1c1
Sequence:CCGGGCGGATTTGCTTAGACATCTTCTCGAGAAGATGTCTAAGCAAATCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200545    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026412.1-1283s1c1
Sequence:CCGGCCTTAGAACTAGGATACTAAACTCGAGTTTAGTATCCTAGTTCTAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026412
VALIDATED
KNSTRN MISSION shRNA Lentiviral Transduction Particles
kinetochore-localized astrin/SPAG5 binding protein
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026412.3-246s21c1
Sequence:CCGGGCTGCGGAGCATTATTTGAAACTCGAGTTTCAAATAATGCTCCGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319898    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026412.3-1281s21c1
Sequence:CCGGCCCTTAGAACTAGGATACTAACTCGAGTTAGTATCCTAGTTCTAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026412.1-247s1c1
Sequence:CCGGGCTGCGGAGCATTATTTGAAACTCGAGTTTCAAATAATGCTCCGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026412.1-968s1c1
Sequence:CCGGCCTTATGTAAGGACGAAGCCACTCGAGTGGCTTCGTCCTTACATAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026412.2-990s1c1
Sequence:CCGGGACTTCACAATAATCCTAGAGCTCGAGCTCTAGGATTATTGTGAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026412.3-414s21c1
Sequence:CCGGGCTACTTCTAAACTACCTGTTCTCGAGAACAGGTAGTTTAGAAGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026412.3-967s21c1
Sequence:CCGGCCTTATGTAAGGACGAAGCCACTCGAGTGGCTTCGTCCTTACATAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191181    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026412.1-1282s1c1
Sequence:CCGGCCCTTAGAACTAGGATACTAACTCGAGTTAGTATCCTAGTTCTAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026412.1-838s1c1
Sequence:CCGGCTCGAAACTTTGAAAGACGAACTCGAGTTCGTCTTTCAAAGTTTCGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026412.1-415s1c1
Sequence:CCGGGCTACTTCTAAACTACCTGTTCTCGAGAACAGGTAGTTTAGAAGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026412.2-447s1c1
Sequence:CCGGGCGGATTTGCTTAGACATCTTCTCGAGAAGATGTCTAAGCAAATCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200545    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026412.1-1283s1c1
Sequence:CCGGCCTTAGAACTAGGATACTAAACTCGAGTTTAGTATCCTAGTTCTAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033286
VALIDATED
KNSTRN MISSION shRNA Bacterial Glycerol Stock
kinetochore-localized astrin/SPAG5 binding protein
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000141120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033286.1-428s1c1
Sequence:CCGGCACCAAACTGAGACGAGAGAACTCGAGTTCTCTCGTCTCAGTTTGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033286.1-569s1c1
Sequence:CCGGCAACAAGCAGTTGCACCAGAACTCGAGTTCTGGTGCAACTGCTTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033286.1-243s1c1
Sequence:CCGGGTTACGATGACCAGTGTGGTTCTCGAGAACCACACTGGTCATCGTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033286.1-721s1c1
Sequence:CCGGCATCACGACAAGAATCCACTACTCGAGTAGTGGATTCTTGTCGTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033286.1-726s1c1
Sequence:CCGGCGACAAGAATCCACTACTGATCTCGAGATCAGTAGTGGATTCTTGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033286.1-839s1c1
Sequence:CCGGCTTAAAGGTAAAGCTGGAGATCTCGAGATCTCCAGCTTTACCTTTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033286.1-764s1c1
Sequence:CCGGGCTGTTAGAAACTTTGCAAGACTCGAGTCTTGCAAAGTTTCTAACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033286.1-860s1c1
Sequence:CCGGGAAAGAGGAAAGAGTCCGATTCTCGAGAATCGGACTCTTTCCTCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033286.1-372s1c1
Sequence:CCGGGTCGATGTTTCCAAACAGCTTCTCGAGAAGCTGTTTGGAAACATCGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033286.1-838s1c1
Sequence:CCGGCCTTAAAGGTAAAGCTGGAGACTCGAGTCTCCAGCTTTACCTTTAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033286
VALIDATED
KNSTRN MISSION shRNA shRNA Plasmid DNA
kinetochore-localized astrin/SPAG5 binding protein
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000141120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033286.1-428s1c1
Sequence:CCGGCACCAAACTGAGACGAGAGAACTCGAGTTCTCTCGTCTCAGTTTGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033286.1-569s1c1
Sequence:CCGGCAACAAGCAGTTGCACCAGAACTCGAGTTCTGGTGCAACTGCTTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033286.1-243s1c1
Sequence:CCGGGTTACGATGACCAGTGTGGTTCTCGAGAACCACACTGGTCATCGTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033286.1-721s1c1
Sequence:CCGGCATCACGACAAGAATCCACTACTCGAGTAGTGGATTCTTGTCGTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033286.1-726s1c1
Sequence:CCGGCGACAAGAATCCACTACTGATCTCGAGATCAGTAGTGGATTCTTGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033286.1-839s1c1
Sequence:CCGGCTTAAAGGTAAAGCTGGAGATCTCGAGATCTCCAGCTTTACCTTTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033286.1-764s1c1
Sequence:CCGGGCTGTTAGAAACTTTGCAAGACTCGAGTCTTGCAAAGTTTCTAACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033286.1-860s1c1
Sequence:CCGGGAAAGAGGAAAGAGTCCGATTCTCGAGAATCGGACTCTTTCCTCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033286.1-372s1c1
Sequence:CCGGGTCGATGTTTCCAAACAGCTTCTCGAGAAGCTGTTTGGAAACATCGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033286.1-838s1c1
Sequence:CCGGCCTTAAAGGTAAAGCTGGAGACTCGAGTCTCCAGCTTTACCTTTAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033286
VALIDATED
KNSTRN MISSION shRNA Lentiviral Transduction Particles
kinetochore-localized astrin/SPAG5 binding protein
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000141120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033286.1-428s1c1
Sequence:CCGGCACCAAACTGAGACGAGAGAACTCGAGTTCTCTCGTCTCAGTTTGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033286.1-569s1c1
Sequence:CCGGCAACAAGCAGTTGCACCAGAACTCGAGTTCTGGTGCAACTGCTTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033286.1-243s1c1
Sequence:CCGGGTTACGATGACCAGTGTGGTTCTCGAGAACCACACTGGTCATCGTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033286.1-721s1c1
Sequence:CCGGCATCACGACAAGAATCCACTACTCGAGTAGTGGATTCTTGTCGTGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033286.1-726s1c1
Sequence:CCGGCGACAAGAATCCACTACTGATCTCGAGATCAGTAGTGGATTCTTGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033286.1-839s1c1
Sequence:CCGGCTTAAAGGTAAAGCTGGAGATCTCGAGATCTCCAGCTTTACCTTTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033286.1-764s1c1
Sequence:CCGGGCTGTTAGAAACTTTGCAAGACTCGAGTCTTGCAAAGTTTCTAACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033286.1-860s1c1
Sequence:CCGGGAAAGAGGAAAGAGTCCGATTCTCGAGAATCGGACTCTTTCCTCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033286.1-372s1c1
Sequence:CCGGGTCGATGTTTCCAAACAGCTTCTCGAGAAGCTGTTTGGAAACATCGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033286.1-838s1c1
Sequence:CCGGCCTTAAAGGTAAAGCTGGAGACTCGAGTCTCCAGCTTTACCTTTAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)