EMAIL THIS PAGE TO A FRIEND

KNTC1

kinetochore associated 1

61 Gene Product Result for
Synonyms: ROD
UniProtKB ID: P50748, A7E2C4
Gene ID:
Human(9735) Summary: This gene encodes a protein that is one of many involved in mechanisms to ensure proper chromosome segregation during cell division. Experimental evidence indicated that the encoded protein functioned in a similar manner to that of the Drosophila rough deal protein. [provided by RefSeq, Jul 2008]
Mouse(208628) kinetochore associated 1
Rat(304477) kinetochore associated 1
Zebrafish(497376) kinetochore associated 1
cow(506353) kinetochore associated 1
Horse(100060263) kinetochore associated 1
domestic cat(101091481) kinetochore associated 1
dog(486254) kinetochore associated 1
chicken(416865) kinetochore associated 1
domestic guinea pig(100723326) kinetochore associated 1
naked mole-rat(101698193) kinetochore associated 1
sheep(101120018) kinetochore associated 1
Domestic Rabbit(100346329) kinetochore associated 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014708 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014708 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014708 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001042421 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001042421 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001042421 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014708 Rosetta Predictions human pricing
NM_001107140 Rosetta Predictions rat pricing
NM_001042421 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014708 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00027327 predicted 6360
2 SASI_Hs02_00346124 predicted 2851
3 SASI_Hs02_00346125 predicted 6136
4 SASI_Hs01_00027329 predicted 3224
5 SASI_Hs01_00027330 predicted 6345
6 SASI_Hs02_00346126 predicted 5485
7 SASI_Hs01_00027333 predicted 4384
8 SASI_Hs01_00027334 predicted 3867
9 SASI_Hs02_00346127 predicted 2362
10 SASI_Hs02_00346128 predicted 5843
11 SASI_Hs01_00027326 predicted 322
12 SASI_Hs01_00027328 predicted 4865
13 SASI_Hs01_00027331 predicted 731
14 SASI_Hs01_00027332 predicted 4147
15 SASI_Hs01_00027335 predicted 5736
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107140 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00225895 predicted 5714
2 SASI_Rn02_00225896 predicted 1442
3 SASI_Rn02_00225897 predicted 2444
4 SASI_Rn02_00225898 predicted 301
5 SASI_Rn02_00225899 predicted 4042
6 SASI_Rn02_00225900 predicted 1362
7 SASI_Rn02_00225901 predicted 4567
8 SASI_Rn02_00225902 predicted 4447
9 SASI_Rn02_00225903 predicted 2308
10 SASI_Rn02_00225904 predicted 4307
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042421 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00173016 predicted 3878
2 SASI_Mm01_00173017 predicted 455
3 SASI_Mm01_00173018 predicted 5035
4 SASI_Mm01_00173019 predicted 2225
5 SASI_Mm02_00290374 predicted 2185
6 SASI_Mm01_00173020 predicted 418
7 SASI_Mm01_00173021 predicted 5412
8 SASI_Mm01_00173022 predicted 3854
9 SASI_Mm01_00173023 predicted 6342
10 SASI_Mm01_00173024 predicted 6007
11 SASI_Mm01_00173025 predicted 3701
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014708
VALIDATED
KNTC1 MISSION shRNA Bacterial Glycerol Stock
kinetochore associated 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000117932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014708.3-985s1c1
Sequence:CCGGGCTGAGTTTATGGGATATTTACTCGAGTAAATATCCCATAAACTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014708.3-4655s1c1
Sequence:CCGGGCCCTTGAGATGGTTCCTTTACTCGAGTAAAGGAACCATCTCAAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014708.3-982s1c1
Sequence:CCGGCGTGCTGAGTTTATGGGATATCTCGAGATATCCCATAAACTCAGCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014708.3-2819s1c1
Sequence:CCGGGCGTTTATGTTATCTGATGATCTCGAGATCATCAGATAACATAAACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014708.3-6350s1c1
Sequence:CCGGGCCAGGCAGTATATCCAGTTACTCGAGTAACTGGATATACTGCCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130659    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014708.3-4862s1c1
Sequence:CCGGCCTCCCGTGGATCTAGAATATCTCGAGATATTCTAGATCCACGGGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127966    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014708.3-2558s1c1
Sequence:CCGGGCCGTGCTCAAGATCATGTATCTCGAGATACATGATCTTGAGCACGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014708.4-6776s21c1
Sequence:CCGGCTTAGTGGATTATCGTAAATCCTCGAGGATTTACGATAATCCACTAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014708.4-2534s21c1
Sequence:CCGGTCTGACACGGACCTCATATTTCTCGAGAAATATGAGGTCCGTGTCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014708.4-985s21c1
Sequence:CCGGGCTGAGTTTATGGGATATTTACTCGAGTAAATATCCCATAAACTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014708.4-4655s21c1
Sequence:CCGGGCCCTTGAGATGGTTCCTTTACTCGAGTAAAGGAACCATCTCAAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014708.4-1241s21c1
Sequence:CCGGATTAGCACAGATACCATATACCTCGAGGTATATGGTATCTGTGCTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014708
VALIDATED
KNTC1 MISSION shRNA shRNA Plasmid DNA
kinetochore associated 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000117932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014708.3-985s1c1
Sequence:CCGGGCTGAGTTTATGGGATATTTACTCGAGTAAATATCCCATAAACTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014708.3-4655s1c1
Sequence:CCGGGCCCTTGAGATGGTTCCTTTACTCGAGTAAAGGAACCATCTCAAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014708.3-982s1c1
Sequence:CCGGCGTGCTGAGTTTATGGGATATCTCGAGATATCCCATAAACTCAGCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014708.3-2819s1c1
Sequence:CCGGGCGTTTATGTTATCTGATGATCTCGAGATCATCAGATAACATAAACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014708.3-6350s1c1
Sequence:CCGGGCCAGGCAGTATATCCAGTTACTCGAGTAACTGGATATACTGCCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130659    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014708.3-4862s1c1
Sequence:CCGGCCTCCCGTGGATCTAGAATATCTCGAGATATTCTAGATCCACGGGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127966    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014708.3-2558s1c1
Sequence:CCGGGCCGTGCTCAAGATCATGTATCTCGAGATACATGATCTTGAGCACGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014708.4-6776s21c1
Sequence:CCGGCTTAGTGGATTATCGTAAATCCTCGAGGATTTACGATAATCCACTAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014708.4-2534s21c1
Sequence:CCGGTCTGACACGGACCTCATATTTCTCGAGAAATATGAGGTCCGTGTCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014708.4-985s21c1
Sequence:CCGGGCTGAGTTTATGGGATATTTACTCGAGTAAATATCCCATAAACTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014708.4-4655s21c1
Sequence:CCGGGCCCTTGAGATGGTTCCTTTACTCGAGTAAAGGAACCATCTCAAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014708.4-1241s21c1
Sequence:CCGGATTAGCACAGATACCATATACCTCGAGGTATATGGTATCTGTGCTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014708
VALIDATED
KNTC1 MISSION shRNA Lentiviral Transduction Particles
kinetochore associated 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000117932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014708.3-985s1c1
Sequence:CCGGGCTGAGTTTATGGGATATTTACTCGAGTAAATATCCCATAAACTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014708.3-4655s1c1
Sequence:CCGGGCCCTTGAGATGGTTCCTTTACTCGAGTAAAGGAACCATCTCAAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014708.3-982s1c1
Sequence:CCGGCGTGCTGAGTTTATGGGATATCTCGAGATATCCCATAAACTCAGCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014708.3-2819s1c1
Sequence:CCGGGCGTTTATGTTATCTGATGATCTCGAGATCATCAGATAACATAAACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014708.3-6350s1c1
Sequence:CCGGGCCAGGCAGTATATCCAGTTACTCGAGTAACTGGATATACTGCCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130659    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014708.3-4862s1c1
Sequence:CCGGCCTCCCGTGGATCTAGAATATCTCGAGATATTCTAGATCCACGGGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127966    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014708.3-2558s1c1
Sequence:CCGGGCCGTGCTCAAGATCATGTATCTCGAGATACATGATCTTGAGCACGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014708.4-6776s21c1
Sequence:CCGGCTTAGTGGATTATCGTAAATCCTCGAGGATTTACGATAATCCACTAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014708.4-2534s21c1
Sequence:CCGGTCTGACACGGACCTCATATTTCTCGAGAAATATGAGGTCCGTGTCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014708.4-985s21c1
Sequence:CCGGGCTGAGTTTATGGGATATTTACTCGAGTAAATATCCCATAAACTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014708.4-4655s21c1
Sequence:CCGGGCCCTTGAGATGGTTCCTTTACTCGAGTAAAGGAACCATCTCAAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014708.4-1241s21c1
Sequence:CCGGATTAGCACAGATACCATATACCTCGAGGTATATGGTATCTGTGCTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001042421
VALIDATED
KNTC1 MISSION shRNA Bacterial Glycerol Stock
kinetochore associated 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000251803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001042421.1-6663s21c1
Sequence:CCGGATGAAGCATCAGCGTTGATAACTCGAGTTATCAACGCTGATGCTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001042421.1-3011s21c1
Sequence:CCGGGCGAAGACATCGGTGGATATTCTCGAGAATATCCACCGATGTCTTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001042421.1-4911s21c1
Sequence:CCGGGACTGCCCTTTCACCTAATACCTCGAGGTATTAGGTGAAAGGGCAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042421.1-1223s21c1
Sequence:CCGGGGAATCAGCACGGACACTATACTCGAGTATAGTGTCCGTGCTGATTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001042421.1-1419s21c1
Sequence:CCGGAGCTTGTTTATAAGGTCAAATCTCGAGATTTGACCTTATAAACAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001042421
VALIDATED
KNTC1 MISSION shRNA shRNA Plasmid DNA
kinetochore associated 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000251803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001042421.1-6663s21c1
Sequence:CCGGATGAAGCATCAGCGTTGATAACTCGAGTTATCAACGCTGATGCTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001042421.1-3011s21c1
Sequence:CCGGGCGAAGACATCGGTGGATATTCTCGAGAATATCCACCGATGTCTTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001042421.1-4911s21c1
Sequence:CCGGGACTGCCCTTTCACCTAATACCTCGAGGTATTAGGTGAAAGGGCAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042421.1-1223s21c1
Sequence:CCGGGGAATCAGCACGGACACTATACTCGAGTATAGTGTCCGTGCTGATTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001042421.1-1419s21c1
Sequence:CCGGAGCTTGTTTATAAGGTCAAATCTCGAGATTTGACCTTATAAACAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001042421
VALIDATED
KNTC1 MISSION shRNA Lentiviral Transduction Particles
kinetochore associated 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000251803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001042421.1-6663s21c1
Sequence:CCGGATGAAGCATCAGCGTTGATAACTCGAGTTATCAACGCTGATGCTTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001042421.1-3011s21c1
Sequence:CCGGGCGAAGACATCGGTGGATATTCTCGAGAATATCCACCGATGTCTTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001042421.1-4911s21c1
Sequence:CCGGGACTGCCCTTTCACCTAATACCTCGAGGTATTAGGTGAAAGGGCAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042421.1-1223s21c1
Sequence:CCGGGGAATCAGCACGGACACTATACTCGAGTATAGTGTCCGTGCTGATTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001042421.1-1419s21c1
Sequence:CCGGAGCTTGTTTATAAGGTCAAATCTCGAGATTTGACCTTATAAACAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)