EMAIL THIS PAGE TO A FRIEND

KPNA2

karyopherin alpha 2 (RAG cohort 1, importin alpha 1)

102 Gene Product Result for
Synonyms: IPOA1 QIP2 RCH1 SRP1alpha
UniProtKB ID: P52292, B9EJD6, Q53YE3, Q9BRU5
Gene ID:
Human(3838) Summary: The import of proteins into the nucleus is a process that involves at least 2 steps. The first is an energy-independent docking of the protein to the nuclear envelope and the second is an energy-dependent translocation through the nuclear pore complex. Imported proteins require a nuclear localization sequence (NLS) which generally consists of a short region of basic amino acids or 2 such regions spaced about 10 amino acids apart. Proteins involved in the first step of nuclear import have been identified in different systems. These include the Xenopus protein importin and its yeast homolog, SRP1 (a suppressor of certain temperature-sensitive mutations of RNA polymerase I in Saccharomyces cerevisiae), which bind to the NLS. KPNA2 protein interacts with the NLSs of DNA helicase Q1 and SV40 T antigen and may be involved in the nuclear transport of proteins. KPNA2 also may play a role in V(D)J recombination [provided by RefSeq, Jul 2008]
Mouse(16647) karyopherin (importin) alpha 2
Rat(85245) karyopherin alpha 2
domestic guinea pig(100719116) karyopherin alpha 2 (RAG cohort 1, importin alpha 1)
naked mole-rat(101709268) karyopherin alpha 2 (RAG cohort 1, importin alpha 1)
sheep(101106952) karyopherin alpha 2 (RAG cohort 1, importin alpha 1)
Zebrafish(436607) karyopherin alpha 2 (RAG cohort 1, importin alpha 1)
cow(513592) karyopherin alpha 2 (RAG cohort 1, importin alpha 1)
domestic cat(101085417) karyopherin alpha 2 (RAG cohort 1, importin alpha 1)
Horse(100053778) karyopherin alpha 2 (RAG cohort 1, importin alpha 1)
dog(480469) karyopherin alpha 2 (RAG cohort 1, importin alpha 1)
chicken(417420) karyopherin alpha 2 (RAG cohort 1, importin alpha 1)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002266 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002266 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002266 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010655 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010655 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010655 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002266 Rosetta Predictions human pricing
NM_053483 Rosetta Predictions rat pricing
NM_010655 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002266 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00130752 predicted 1492
2 SASI_Hs01_00130753 predicted 1500
3 SASI_Hs01_00130754 predicted 1439
4 SASI_Hs02_00333527 predicted 432
5 SASI_Hs02_00333528 predicted 333
6 SASI_Hs02_00333529 predicted 1234
7 SASI_Hs02_00333530 predicted 273
8 SASI_Hs01_00130756 predicted 562
9 SASI_Hs02_00333531 predicted 861
10 SASI_Hs01_00130757 predicted 483
11 SASI_Hs01_00130751 predicted 511
12 SASI_Hs01_00130755 predicted 1383
13 SASI_Hs01_00130758 predicted 1276
14 SASI_Hs01_00130759 predicted 310
15 SASI_Hs01_00130760 predicted 1577
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053483 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00046678 predicted 856
2 SASI_Rn02_00266075 predicted 1108
3 SASI_Rn02_00266076 predicted 207
4 SASI_Rn02_00266077 predicted 658
5 SASI_Rn02_00266078 predicted 319
6 SASI_Rn02_00266079 predicted 1452
7 SASI_Rn02_00266080 predicted 404
8 SASI_Rn02_00266081 predicted 337
9 SASI_Rn02_00266082 predicted 239
10 SASI_Rn01_00046682 predicted 1330
11 SASI_Rn01_00046679 predicted 1164
12 SASI_Rn01_00046680 predicted 260
13 SASI_Rn01_00046681 predicted 1330
14 SASI_Rn01_00046683 predicted 677
15 SASI_Rn01_00046684 predicted 712
16 SASI_Rn01_00046685 predicted 1324
17 SASI_Rn01_00046686 predicted 1625
18 SASI_Rn01_00046687 predicted 1668
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010655 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00035456 predicted 385
2 SASI_Mm01_00035457 predicted 1499
3 SASI_Mm01_00035458 predicted 1111
4 SASI_Mm01_00035461 predicted 1289
5 SASI_Mm02_00319050 predicted 1494
6 SASI_Mm01_00035462 predicted 1340
7 SASI_Mm02_00319051 predicted 392
8 SASI_Mm01_00035463 predicted 476
9 SASI_Mm01_00035465 predicted 218
10 SASI_Mm02_00319052 predicted 212
11 SASI_Mm01_00035459 predicted 367
12 SASI_Mm01_00035460 predicted 1641
13 SASI_Mm01_00035464 predicted 1496
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002266
VALIDATED
KPNA2 MISSION shRNA Bacterial Glycerol Stock
karyopherin alpha 2 (RAG cohort 1, importin alpha 1)
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_002266.1-484s1c1
Sequence:CCGGGCTGGTTTGATTCCGAAATTTCTCGAGAAATTTCGGAATCAAACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_002266.1-367s1c1
Sequence:CCGGGATGACATTGTCAAAGGCATACTCGAGTATGCCTTTGACAATGTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_002266.1-1661s1c1
Sequence:CCGGCTACCTCTGAAGGCTACACTTCTCGAGAAGTGTAGCCTTCAGAGGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_002266.1-821s1c1
Sequence:CCGGCCTGGACACTTTCTAATCTTTCTCGAGAAAGATTAGAAAGTGTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002266.1-985s1c1
Sequence:CCGGCGAATTGGCATGGTGGTGAAACTCGAGTTTCACCACCATGCCAATTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002266.2-1325s21c1
Sequence:GTACCGGTGTGGGCCGTGACCAACTATACTCGAGTATAGTTGGTCACGGCCCACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002266.2-796s21c1
Sequence:GTACCGGGCATGTGGCTACTTACGTAATCTCGAGATTACGTAAGTAGCCACATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002266.2-484s21c1
Sequence:CCGGGCTGGTTTGATTCCGAAATTTCTCGAGAAATTTCGGAATCAAACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_002266.2-821s21c1
Sequence:CCGGCCTGGACACTTTCTAATCTTTCTCGAGAAAGATTAGAAAGTGTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293910    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_002266.2-1724s21c1
Sequence:CCGGTCATGTAGCTGAGACATAAATCTCGAGATTTATGTCTCAGCTACATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_002266.2-1378s21c1
Sequence:CCGGCTTGTTCACTGTGGCATAATACTCGAGTATTATGCCACAGTGAACAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002266.2-1661s21c1
Sequence:CCGGCTACCTCTGAAGGCTACACTTCTCGAGAAGTGTAGCCTTCAGAGGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002266.2-371s21c1
Sequence:GTACCGGACATTGTCAAAGGCATAAATACTCGAGTATTTATGCCTTTGACAATGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002266
VALIDATED
KPNA2 MISSION shRNA shRNA Plasmid DNA
karyopherin alpha 2 (RAG cohort 1, importin alpha 1)
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_002266.1-484s1c1
Sequence:CCGGGCTGGTTTGATTCCGAAATTTCTCGAGAAATTTCGGAATCAAACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_002266.1-367s1c1
Sequence:CCGGGATGACATTGTCAAAGGCATACTCGAGTATGCCTTTGACAATGTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_002266.1-1661s1c1
Sequence:CCGGCTACCTCTGAAGGCTACACTTCTCGAGAAGTGTAGCCTTCAGAGGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_002266.1-821s1c1
Sequence:CCGGCCTGGACACTTTCTAATCTTTCTCGAGAAAGATTAGAAAGTGTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002266.1-985s1c1
Sequence:CCGGCGAATTGGCATGGTGGTGAAACTCGAGTTTCACCACCATGCCAATTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002266.2-1325s21c1
Sequence:GTACCGGTGTGGGCCGTGACCAACTATACTCGAGTATAGTTGGTCACGGCCCACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002266.2-796s21c1
Sequence:GTACCGGGCATGTGGCTACTTACGTAATCTCGAGATTACGTAAGTAGCCACATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002266.2-484s21c1
Sequence:CCGGGCTGGTTTGATTCCGAAATTTCTCGAGAAATTTCGGAATCAAACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_002266.2-821s21c1
Sequence:CCGGCCTGGACACTTTCTAATCTTTCTCGAGAAAGATTAGAAAGTGTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293910    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_002266.2-1724s21c1
Sequence:CCGGTCATGTAGCTGAGACATAAATCTCGAGATTTATGTCTCAGCTACATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_002266.2-1378s21c1
Sequence:CCGGCTTGTTCACTGTGGCATAATACTCGAGTATTATGCCACAGTGAACAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002266.2-1661s21c1
Sequence:CCGGCTACCTCTGAAGGCTACACTTCTCGAGAAGTGTAGCCTTCAGAGGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002266.2-371s21c1
Sequence:GTACCGGACATTGTCAAAGGCATAAATACTCGAGTATTTATGCCTTTGACAATGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002266
VALIDATED
KPNA2 MISSION shRNA Lentiviral Transduction Particles
karyopherin alpha 2 (RAG cohort 1, importin alpha 1)
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_002266.1-484s1c1
Sequence:CCGGGCTGGTTTGATTCCGAAATTTCTCGAGAAATTTCGGAATCAAACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_002266.1-367s1c1
Sequence:CCGGGATGACATTGTCAAAGGCATACTCGAGTATGCCTTTGACAATGTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_002266.1-1661s1c1
Sequence:CCGGCTACCTCTGAAGGCTACACTTCTCGAGAAGTGTAGCCTTCAGAGGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_002266.1-821s1c1
Sequence:CCGGCCTGGACACTTTCTAATCTTTCTCGAGAAAGATTAGAAAGTGTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002266.1-985s1c1
Sequence:CCGGCGAATTGGCATGGTGGTGAAACTCGAGTTTCACCACCATGCCAATTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002266.2-1325s21c1
Sequence:GTACCGGTGTGGGCCGTGACCAACTATACTCGAGTATAGTTGGTCACGGCCCACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002266.2-796s21c1
Sequence:GTACCGGGCATGTGGCTACTTACGTAATCTCGAGATTACGTAAGTAGCCACATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002266.2-484s21c1
Sequence:CCGGGCTGGTTTGATTCCGAAATTTCTCGAGAAATTTCGGAATCAAACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_002266.2-821s21c1
Sequence:CCGGCCTGGACACTTTCTAATCTTTCTCGAGAAAGATTAGAAAGTGTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293910    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_002266.2-1724s21c1
Sequence:CCGGTCATGTAGCTGAGACATAAATCTCGAGATTTATGTCTCAGCTACATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_002266.2-1378s21c1
Sequence:CCGGCTTGTTCACTGTGGCATAATACTCGAGTATTATGCCACAGTGAACAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002266.2-1661s21c1
Sequence:CCGGCTACCTCTGAAGGCTACACTTCTCGAGAAGTGTAGCCTTCAGAGGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002266.2-371s21c1
Sequence:GTACCGGACATTGTCAAAGGCATAAATACTCGAGTATTTATGCCTTTGACAATGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010655
VALIDATED
KPNA2 MISSION shRNA Bacterial Glycerol Stock
karyopherin alpha 2 (RAG cohort 1, importin alpha 1)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093514    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010655.2-1814s1c1
Sequence:CCGGGTGTTCTCATAGATTTGTCTTCTCGAGAAGACAAATCTATGAGAACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010655.2-669s1c1
Sequence:CCGGCCCAGCGTTTATTTCTCTCTTCTCGAGAAGAGAGAAATAAACGCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010655.2-866s1c1
Sequence:CCGGCCTGGACACTTTCAAACCTTTCTCGAGAAAGGTTTGAAAGTGTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010655.2-1370s1c1
Sequence:CCGGCGTGGGCTATAACCAACTATACTCGAGTATAGTTGGTTATAGCCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010655.2-213s1c1
Sequence:CCGGCCGACTTAACAGGTTCAAGAACTCGAGTTCTTGAACCTGTTAAGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010655.3-1344s21c1
Sequence:GTACCGGTCCTCTCTAAGGCGGACTTTACTCGAGTAAAGTCCGCCTTAGAGAGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010655.3-478s21c1
Sequence:GTACCGGTACTCAAGCTGCTCGGAAATTCTCGAGAATTTCCGAGCAGCTTGAGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010655.3-675s21c1
Sequence:GTACCGGGTGCTATCCCAGCGTTTATTTCTCGAGAAATAAACGCTGGGATAGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010655
VALIDATED
KPNA2 MISSION shRNA shRNA Plasmid DNA
karyopherin alpha 2 (RAG cohort 1, importin alpha 1)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093514    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010655.2-1814s1c1
Sequence:CCGGGTGTTCTCATAGATTTGTCTTCTCGAGAAGACAAATCTATGAGAACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010655.2-669s1c1
Sequence:CCGGCCCAGCGTTTATTTCTCTCTTCTCGAGAAGAGAGAAATAAACGCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010655.2-866s1c1
Sequence:CCGGCCTGGACACTTTCAAACCTTTCTCGAGAAAGGTTTGAAAGTGTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010655.2-1370s1c1
Sequence:CCGGCGTGGGCTATAACCAACTATACTCGAGTATAGTTGGTTATAGCCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010655.2-213s1c1
Sequence:CCGGCCGACTTAACAGGTTCAAGAACTCGAGTTCTTGAACCTGTTAAGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010655.3-1344s21c1
Sequence:GTACCGGTCCTCTCTAAGGCGGACTTTACTCGAGTAAAGTCCGCCTTAGAGAGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010655.3-478s21c1
Sequence:GTACCGGTACTCAAGCTGCTCGGAAATTCTCGAGAATTTCCGAGCAGCTTGAGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010655.3-675s21c1
Sequence:GTACCGGGTGCTATCCCAGCGTTTATTTCTCGAGAAATAAACGCTGGGATAGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010655
VALIDATED
KPNA2 MISSION shRNA Lentiviral Transduction Particles
karyopherin alpha 2 (RAG cohort 1, importin alpha 1)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093514    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010655.2-1814s1c1
Sequence:CCGGGTGTTCTCATAGATTTGTCTTCTCGAGAAGACAAATCTATGAGAACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010655.2-669s1c1
Sequence:CCGGCCCAGCGTTTATTTCTCTCTTCTCGAGAAGAGAGAAATAAACGCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010655.2-866s1c1
Sequence:CCGGCCTGGACACTTTCAAACCTTTCTCGAGAAAGGTTTGAAAGTGTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010655.2-1370s1c1
Sequence:CCGGCGTGGGCTATAACCAACTATACTCGAGTATAGTTGGTTATAGCCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010655.2-213s1c1
Sequence:CCGGCCGACTTAACAGGTTCAAGAACTCGAGTTCTTGAACCTGTTAAGTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010655.3-1344s21c1
Sequence:GTACCGGTCCTCTCTAAGGCGGACTTTACTCGAGTAAAGTCCGCCTTAGAGAGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010655.3-478s21c1
Sequence:GTACCGGTACTCAAGCTGCTCGGAAATTCTCGAGAATTTCCGAGCAGCTTGAGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010655.3-675s21c1
Sequence:GTACCGGGTGCTATCCCAGCGTTTATTTCTCGAGAAATAAACGCTGGGATAGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)