EMAIL THIS PAGE TO A FRIEND

KPNA6

karyopherin alpha 6 (importin alpha 7)

158 Gene Product Result for
Synonyms: IPOA7 KPNA7
UniProtKB ID: O60684, B2RDC7, D3DPP5, Q5VVU3
Gene ID:
Human(23633) Summary: Nucleocytoplasmic transport, a signal- and energy-dependent process, takes place through nuclear pore complexes embedded in the nuclear envelope. The import of proteins containing a nuclear localization signal (NLS) requires the NLS import receptor, a heterodimer of importin alpha and beta subunits also known as karyopherins. Importin alpha binds the NLS-containing cargo in the cytoplasm and importin beta docks the complex at the cytoplasmic side of the nuclear pore complex. In the presence of nucleoside triphosphates and the small GTP binding protein Ran, the complex moves into the nuclear pore complex and the importin subunits dissociate. Importin alpha enters the nucleoplasm with its passenger protein and importin beta remains at the pore. The protein encoded by this gene is a member of the importin alpha family. [provided by RefSeq, Jul 2008]
Mouse(16650) karyopherin (importin) alpha 6
Rat(362607) karyopherin alpha 6 (importin alpha 7)
domestic guinea pig(100724106) karyopherin alpha 6 (importin alpha 7)
naked mole-rat(101709271) karyopherin alpha 6 (importin alpha 7)
sheep(101117141) karyopherin alpha 6 (importin alpha 7)
chicken(419656) karyopherin alpha 6 (importin alpha 7)
cow(531602) karyopherin alpha 6 (importin alpha 7)
domestic cat(101097823) karyopherin alpha 6 (importin alpha 7)
dog(487314) karyopherin alpha 6 (importin alpha 7)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012316 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012316 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012316 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008468 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008468 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008468 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012316 Rosetta Predictions human pricing
NM_001015029 Rosetta Predictions rat pricing
XM_001061648 Rosetta Predictions rat pricing
NM_008468 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012316 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00224925 predicted 834
2 SASI_Hs01_00224927 predicted 497
3 SASI_Hs01_00224930 predicted 1209
4 SASI_Hs02_00344087 predicted 707
5 SASI_Hs01_00224931 predicted 791
6 SASI_Hs02_00344088 predicted 234
7 SASI_Hs01_00224932 predicted 696
8 SASI_Hs01_00224933 predicted 891
9 SASI_Hs01_00224934 predicted 414
10 SASI_Hs02_00344089 predicted 380
11 SASI_Hs01_00224926 predicted 700
12 SASI_Hs01_00224928 predicted 265
13 SASI_Hs01_00224929 predicted 368
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001015029 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00202135 predicted 787
2 SASI_Rn02_00202136 predicted 445
3 SASI_Rn02_00202137 predicted 419
4 SASI_Rn02_00202138 predicted 1289
5 SASI_Rn02_00202139 predicted 1542
6 SASI_Rn02_00202140 predicted 378
7 SASI_Rn02_00202141 predicted 1270
8 SASI_Rn02_00202142 predicted 560
9 SASI_Rn02_00202143 predicted 662
10 SASI_Rn02_00202144 predicted 1321
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061648 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00300866 predicted 595
2 SASI_Rn02_00300867 predicted 1251
3 SASI_Rn02_00300868 predicted 947
4 SASI_Rn02_00300869 predicted 1203
5 SASI_Rn02_00300870 predicted 990
6 SASI_Rn02_00300871 predicted 652
7 SASI_Rn02_00300872 predicted 866
8 SASI_Rn02_00300873 predicted 682
9 SASI_Rn02_00300874 predicted 1287
10 SASI_Rn02_00300875 predicted 1150
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008468 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00153588 predicted 1314
2 SASI_Mm01_00153590 predicted 1124
3 SASI_Mm01_00153591 predicted 409
4 SASI_Mm01_00153592 predicted 1569
5 SASI_Mm01_00153593 predicted 1004
6 SASI_Mm01_00153594 predicted 472
7 SASI_Mm01_00153595 predicted 1300
8 SASI_Mm01_00153596 predicted 1347
9 SASI_Mm01_00153597 predicted 359
10 SASI_Mm02_00313971 predicted 965
11 SASI_Mm01_00153589 predicted 460
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012316
VALIDATED
KPNA6 MISSION shRNA Bacterial Glycerol Stock
karyopherin alpha 6 (importin alpha 7)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012316.3-253s1c1
Sequence:CCGGGCTGCCATGTTCGATAGTCTTCTCGAGAAGACTATCGAACATGGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012316.3-1216s1c1
Sequence:CCGGCCTGTGTTGATCGAAATCCTTCTCGAGAAGGATTTCGATCAACACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012316.3-223s1c1
Sequence:CCGGCGGAGAAATGTGGAGCTGATTCTCGAGAATCAGCTCCACATTTCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012316.3-1464s1c1
Sequence:CCGGCAATCCTTATTGTGGCCTCATCTCGAGATGAGGCCACAATAAGGATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012316.3-1061s1c1
Sequence:CCGGCCCAGGTCATTCTTAACTGTTCTCGAGAACAGTTAAGAATGACCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293221    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012316.4-2139s21c1
Sequence:CCGGTACTTGAGCAGACGGTATATTCTCGAGAATATACCGTCTGCTCAAGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012316.4-1229s21c1
Sequence:CCGGCCTGTGTTGATCGAAATCCTTCTCGAGAAGGATTTCGATCAACACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012316.4-236s21c1
Sequence:CCGGCGGAGAAATGTGGAGCTGATTCTCGAGAATCAGCTCCACATTTCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012316.4-1682s21c1
Sequence:CCGGGAGGGCTTCCAGCTATAATATCTCGAGATATTATAGCTGGAAGCCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012316.4-524s21c1
Sequence:CCGGGCCTGGGCTCTAACGAATATTCTCGAGAATATTCGTTAGAGCCCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012316
VALIDATED
KPNA6 MISSION shRNA shRNA Plasmid DNA
karyopherin alpha 6 (importin alpha 7)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012316.3-253s1c1
Sequence:CCGGGCTGCCATGTTCGATAGTCTTCTCGAGAAGACTATCGAACATGGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012316.3-1216s1c1
Sequence:CCGGCCTGTGTTGATCGAAATCCTTCTCGAGAAGGATTTCGATCAACACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012316.3-223s1c1
Sequence:CCGGCGGAGAAATGTGGAGCTGATTCTCGAGAATCAGCTCCACATTTCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012316.3-1464s1c1
Sequence:CCGGCAATCCTTATTGTGGCCTCATCTCGAGATGAGGCCACAATAAGGATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012316.3-1061s1c1
Sequence:CCGGCCCAGGTCATTCTTAACTGTTCTCGAGAACAGTTAAGAATGACCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293221    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012316.4-2139s21c1
Sequence:CCGGTACTTGAGCAGACGGTATATTCTCGAGAATATACCGTCTGCTCAAGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012316.4-1229s21c1
Sequence:CCGGCCTGTGTTGATCGAAATCCTTCTCGAGAAGGATTTCGATCAACACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012316.4-236s21c1
Sequence:CCGGCGGAGAAATGTGGAGCTGATTCTCGAGAATCAGCTCCACATTTCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012316.4-1682s21c1
Sequence:CCGGGAGGGCTTCCAGCTATAATATCTCGAGATATTATAGCTGGAAGCCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012316.4-524s21c1
Sequence:CCGGGCCTGGGCTCTAACGAATATTCTCGAGAATATTCGTTAGAGCCCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012316
VALIDATED
KPNA6 MISSION shRNA Lentiviral Transduction Particles
karyopherin alpha 6 (importin alpha 7)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012316.3-253s1c1
Sequence:CCGGGCTGCCATGTTCGATAGTCTTCTCGAGAAGACTATCGAACATGGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012316.3-1216s1c1
Sequence:CCGGCCTGTGTTGATCGAAATCCTTCTCGAGAAGGATTTCGATCAACACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012316.3-223s1c1
Sequence:CCGGCGGAGAAATGTGGAGCTGATTCTCGAGAATCAGCTCCACATTTCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012316.3-1464s1c1
Sequence:CCGGCAATCCTTATTGTGGCCTCATCTCGAGATGAGGCCACAATAAGGATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012316.3-1061s1c1
Sequence:CCGGCCCAGGTCATTCTTAACTGTTCTCGAGAACAGTTAAGAATGACCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293221    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012316.4-2139s21c1
Sequence:CCGGTACTTGAGCAGACGGTATATTCTCGAGAATATACCGTCTGCTCAAGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012316.4-1229s21c1
Sequence:CCGGCCTGTGTTGATCGAAATCCTTCTCGAGAAGGATTTCGATCAACACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012316.4-236s21c1
Sequence:CCGGCGGAGAAATGTGGAGCTGATTCTCGAGAATCAGCTCCACATTTCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012316.4-1682s21c1
Sequence:CCGGGAGGGCTTCCAGCTATAATATCTCGAGATATTATAGCTGGAAGCCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012316.4-524s21c1
Sequence:CCGGGCCTGGGCTCTAACGAATATTCTCGAGAATATTCGTTAGAGCCCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008468
VALIDATED
KPNA6 MISSION shRNA Bacterial Glycerol Stock
karyopherin alpha 6 (importin alpha 7)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008468.1-1017s1c1
Sequence:CCGGCCACCTACTGAGCAGCTCTAACTCGAGTTAGAGCTGCTCAGTAGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008468.1-331s1c1
Sequence:CCGGCCTCCAATAGATGAAGTTATTCTCGAGAATAACTTCATCTATTGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008468.1-358s1c1
Sequence:CCGGCCAGGAGTAGTTGATCGGTTTCTCGAGAAACCGATCAACTACTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008468.1-977s1c1
Sequence:CCGGCCCAGGTCATTCTTAATTGTTCTCGAGAACAATTAAGAATGACCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008468.1-1096s1c1
Sequence:CCGGGCTCAAATACAGGCTGTCATACTCGAGTATGACAGCCTGTATTTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008468.4-1679s21c1
Sequence:CCGGTGGAGGGCTTCCAGCTATAATCTCGAGATTATAGCTGGAAGCCCTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008468.4-1029s21c1
Sequence:CCGGCTTGAGAGCTGTGGGTAATATCTCGAGATATTACCCACAGCTCTCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008468.4-1073s21c1
Sequence:CCGGCCCAGGTCATTCTTAATTGTTCTCGAGAACAATTAAGAATGACCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313126    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008468.4-2193s21c1
Sequence:CCGGTTCTTGCTCTGACCCATATTACTCGAGTAATATGGGTCAGAGCAAGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008468.4-377s21c1
Sequence:CCGGAGTTAGCAACCACGCAGAAATCTCGAGATTTCTGCGTGGTTGCTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008468
VALIDATED
KPNA6 MISSION shRNA shRNA Plasmid DNA
karyopherin alpha 6 (importin alpha 7)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008468.1-1017s1c1
Sequence:CCGGCCACCTACTGAGCAGCTCTAACTCGAGTTAGAGCTGCTCAGTAGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008468.1-331s1c1
Sequence:CCGGCCTCCAATAGATGAAGTTATTCTCGAGAATAACTTCATCTATTGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008468.1-358s1c1
Sequence:CCGGCCAGGAGTAGTTGATCGGTTTCTCGAGAAACCGATCAACTACTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008468.1-977s1c1
Sequence:CCGGCCCAGGTCATTCTTAATTGTTCTCGAGAACAATTAAGAATGACCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008468.1-1096s1c1
Sequence:CCGGGCTCAAATACAGGCTGTCATACTCGAGTATGACAGCCTGTATTTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008468.4-1679s21c1
Sequence:CCGGTGGAGGGCTTCCAGCTATAATCTCGAGATTATAGCTGGAAGCCCTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008468.4-1029s21c1
Sequence:CCGGCTTGAGAGCTGTGGGTAATATCTCGAGATATTACCCACAGCTCTCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008468.4-1073s21c1
Sequence:CCGGCCCAGGTCATTCTTAATTGTTCTCGAGAACAATTAAGAATGACCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313126    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008468.4-2193s21c1
Sequence:CCGGTTCTTGCTCTGACCCATATTACTCGAGTAATATGGGTCAGAGCAAGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008468.4-377s21c1
Sequence:CCGGAGTTAGCAACCACGCAGAAATCTCGAGATTTCTGCGTGGTTGCTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008468
VALIDATED
KPNA6 MISSION shRNA Lentiviral Transduction Particles
karyopherin alpha 6 (importin alpha 7)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008468.1-1017s1c1
Sequence:CCGGCCACCTACTGAGCAGCTCTAACTCGAGTTAGAGCTGCTCAGTAGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008468.1-331s1c1
Sequence:CCGGCCTCCAATAGATGAAGTTATTCTCGAGAATAACTTCATCTATTGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008468.1-358s1c1
Sequence:CCGGCCAGGAGTAGTTGATCGGTTTCTCGAGAAACCGATCAACTACTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008468.1-977s1c1
Sequence:CCGGCCCAGGTCATTCTTAATTGTTCTCGAGAACAATTAAGAATGACCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008468.1-1096s1c1
Sequence:CCGGGCTCAAATACAGGCTGTCATACTCGAGTATGACAGCCTGTATTTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008468.4-1679s21c1
Sequence:CCGGTGGAGGGCTTCCAGCTATAATCTCGAGATTATAGCTGGAAGCCCTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008468.4-1029s21c1
Sequence:CCGGCTTGAGAGCTGTGGGTAATATCTCGAGATATTACCCACAGCTCTCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008468.4-1073s21c1
Sequence:CCGGCCCAGGTCATTCTTAATTGTTCTCGAGAACAATTAAGAATGACCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313126    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008468.4-2193s21c1
Sequence:CCGGTTCTTGCTCTGACCCATATTACTCGAGTAATATGGGTCAGAGCAAGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008468.4-377s21c1
Sequence:CCGGAGTTAGCAACCACGCAGAAATCTCGAGATTTCTGCGTGGTTGCTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)