EMAIL THIS PAGE TO A FRIEND

KPNA7

karyopherin alpha 7 (importin alpha 8)

84 Gene Product Result for
UniProtKB ID: A9QM74, A4D277
Gene ID:
Mouse(381686) karyopherin alpha 7 (importin alpha 8)
Rat(690504) karyopherin alpha 7
Zebrafish(406343) karyopherin alpha 7 (importin alpha 8)
chicken(416488) karyopherin alpha 7 (importin alpha 8)
dog(489863) karyopherin alpha 7 (importin alpha 8)
cow(789280) karyopherin alpha 7 (importin alpha 8)
Horse(100146627) karyopherin alpha 7 (importin alpha 8)
domestic cat(101095459) karyopherin alpha 7 (importin alpha 8)
sheep(101114078) karyopherin alpha 7 (importin alpha 8)
domestic guinea pig(100714397) karyopherin alpha 7 (importin alpha 8)
naked mole-rat(101724255) karyopherin alpha 7 (importin alpha 8)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001013774 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001013774 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001013774 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001145715 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001145715 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001145715 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_376655 Rosetta Predictions human pricing
XR_015552 Rosetta Predictions human pricing
XR_015714 Rosetta Predictions human pricing
XR_041424 Rosetta Predictions human pricing
XR_041425 Rosetta Predictions human pricing
XM_001074637 Rosetta Predictions rat pricing
NM_001013774 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_376655 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00291542 predicted 535
2 SASI_Hs01_00291543 predicted 587
3 SASI_Hs01_00291544 predicted 306
4 SASI_Hs01_00291545 predicted 380
5 SASI_Hs01_00291546 predicted 507
6 SASI_Hs01_00291547 predicted 393
7 SASI_Hs01_00291548 predicted 544
8 SASI_Hs01_00291549 predicted 571
9 SASI_Hs01_00291550 predicted 423
10 SASI_Hs01_00291551 predicted 526
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_015552 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00488486 predicted 1453
2 SASI_Hs02_00488487 predicted 646
3 SASI_Hs02_00488488 predicted 1379
4 SASI_Hs02_00488489 predicted 639
5 SASI_Hs02_00488490 predicted 1440
6 SASI_Hs02_00488491 predicted 381
7 SASI_Hs02_00488492 predicted 727
8 SASI_Hs02_00488493 predicted 984
9 SASI_Hs02_00488494 predicted 271
10 SASI_Hs02_00488495 predicted 1023
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_015714 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00488966 predicted 1419
2 SASI_Hs02_00488967 predicted 1450
3 SASI_Hs02_00488968 predicted 372
4 SASI_Hs02_00488969 predicted 1435
5 SASI_Hs02_00488970 predicted 381
6 SASI_Hs02_00488971 predicted 726
7 SASI_Hs02_00488972 predicted 1023
8 SASI_Hs02_00488973 predicted 1475
9 SASI_Hs02_00488974 predicted 379
10 SASI_Hs02_00488975 predicted 631
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041424 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00527236 predicted 1448
2 SASI_Hs02_00527237 predicted 642
3 SASI_Hs02_00527238 predicted 1383
4 SASI_Hs02_00527239 predicted 1436
5 SASI_Hs02_00527240 predicted 631
6 SASI_Hs02_00527241 predicted 386
7 SASI_Hs02_00527242 predicted 725
8 SASI_Hs02_00527243 predicted 273
9 SASI_Hs02_00527244 predicted 1020
10 SASI_Hs02_00527245 predicted 1475
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041425 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00527246 predicted 1449
2 SASI_Hs02_00527247 predicted 642
3 SASI_Hs02_00527248 predicted 1383
4 SASI_Hs02_00527249 predicted 635
5 SASI_Hs02_00527250 predicted 1438
6 SASI_Hs02_00527251 predicted 389
7 SASI_Hs02_00527252 predicted 731
8 SASI_Hs02_00527253 predicted 988
9 SASI_Hs02_00527254 predicted 274
10 SASI_Hs02_00527255 predicted 1017
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074637 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00346866 predicted 306
2 SASI_Rn02_00346867 predicted 660
3 SASI_Rn02_00346868 predicted 600
4 SASI_Rn02_00346869 predicted 274
5 SASI_Rn02_00346870 predicted 601
6 SASI_Rn02_00346871 predicted 918
7 SASI_Rn02_00346872 predicted 619
8 SASI_Rn02_00346873 predicted 219
9 SASI_Rn02_00346874 predicted 755
10 SASI_Rn02_00346875 predicted 626
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013774 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00287320 predicted 537
2 SASI_Mm01_00053409 predicted 503
3 SASI_Mm01_00053410 predicted 451
4 SASI_Mm02_00287321 predicted 340
5 SASI_Mm02_00287322 predicted 459
6 SASI_Mm02_00287323 predicted 446
7 SASI_Mm02_00287324 predicted 1340
8 SASI_Mm01_00053413 predicted 1663
9 SASI_Mm02_00287325 predicted 1033
10 SASI_Mm02_00287326 predicted 888
11 SASI_Mm01_00053407 predicted 1385
12 SASI_Mm01_00053408 predicted 1160
13 SASI_Mm01_00053411 predicted 1133
14 SASI_Mm01_00053412 predicted 1765
15 SASI_Mm01_00053414 predicted 1319
16 SASI_Mm01_00053415 predicted 1795
17 SASI_Mm01_00053416 predicted 418
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013774
KPNA7 MISSION shRNA Bacterial Glycerol Stock
karyopherin alpha 7 (importin alpha 8)
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000449295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013774.2-1082s21c1
Sequence:CCGGGCCCAGGCTTGTAGAGCTTATCTCGAGATAAGCTCTACAAGCCTGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093344    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013774.1-1813s1c1
Sequence:CCGGGCGTGGCTTCTGGCGATAGTACTCGAGTACTATCGCCAGAAGCCACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013774.1-461s1c1
Sequence:CCGGCGGTGAATAGTTCAGATCCAACTCGAGTTGGATCTGAACTATTCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013774.1-1659s1c1
Sequence:CCGGCCTGGACATCATCGAGAAATACTCGAGTATTTCTCGATGATGTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013774.1-1127s1c1
Sequence:CCGGCGATACCTTGTCTCCACACTACTCGAGTAGTGTGGAGACAAGGTATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013774.1-537s1c1
Sequence:CCGGCCCTCCTCTCAATTTGATTATCTCGAGATAATCAAATTGAGAGGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013774
KPNA7 MISSION shRNA shRNA Plasmid DNA
karyopherin alpha 7 (importin alpha 8)
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000449295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013774.2-1082s21c1
Sequence:CCGGGCCCAGGCTTGTAGAGCTTATCTCGAGATAAGCTCTACAAGCCTGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093344    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013774.1-1813s1c1
Sequence:CCGGGCGTGGCTTCTGGCGATAGTACTCGAGTACTATCGCCAGAAGCCACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013774.1-461s1c1
Sequence:CCGGCGGTGAATAGTTCAGATCCAACTCGAGTTGGATCTGAACTATTCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013774.1-1659s1c1
Sequence:CCGGCCTGGACATCATCGAGAAATACTCGAGTATTTCTCGATGATGTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013774.1-1127s1c1
Sequence:CCGGCGATACCTTGTCTCCACACTACTCGAGTAGTGTGGAGACAAGGTATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013774.1-537s1c1
Sequence:CCGGCCCTCCTCTCAATTTGATTATCTCGAGATAATCAAATTGAGAGGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013774
KPNA7 MISSION shRNA Lentiviral Transduction Particles
karyopherin alpha 7 (importin alpha 8)
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000449295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013774.2-1082s21c1
Sequence:CCGGGCCCAGGCTTGTAGAGCTTATCTCGAGATAAGCTCTACAAGCCTGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093344    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013774.1-1813s1c1
Sequence:CCGGGCGTGGCTTCTGGCGATAGTACTCGAGTACTATCGCCAGAAGCCACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013774.1-461s1c1
Sequence:CCGGCGGTGAATAGTTCAGATCCAACTCGAGTTGGATCTGAACTATTCACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013774.1-1659s1c1
Sequence:CCGGCCTGGACATCATCGAGAAATACTCGAGTATTTCTCGATGATGTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013774.1-1127s1c1
Sequence:CCGGCGATACCTTGTCTCCACACTACTCGAGTAGTGTGGAGACAAGGTATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013774.1-537s1c1
Sequence:CCGGCCCTCCTCTCAATTTGATTATCTCGAGATAATCAAATTGAGAGGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001145715
KPNA7 MISSION shRNA Bacterial Glycerol Stock
karyopherin alpha 7 (importin alpha 8)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000336961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145715.1-602s21c1
Sequence:CCGGCACATCTCCTAGCCTTGATTTCTCGAGAAATCAAGGCTAGGAGATGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145715.1-244s21c1
Sequence:CCGGTCAGATCCAGTCCTATGTTTCCTCGAGGAAACATAGGACTGGATCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145715.1-1401s21c1
Sequence:CCGGGCTGCATGAGAACCGTCAAATCTCGAGATTTGACGGTTCTCATGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145715.1-1495s21c1
Sequence:CCGGCAAGTCATAGACCAAGATTATCTCGAGATAATCTTGGTCTATGACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145715.1-206s21c1
Sequence:CCGGGCCTCACTCTGGGTGAAATAACTCGAGTTATTTCACCCAGAGTGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001145715
KPNA7 MISSION shRNA shRNA Plasmid DNA
karyopherin alpha 7 (importin alpha 8)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000336961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145715.1-602s21c1
Sequence:CCGGCACATCTCCTAGCCTTGATTTCTCGAGAAATCAAGGCTAGGAGATGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145715.1-244s21c1
Sequence:CCGGTCAGATCCAGTCCTATGTTTCCTCGAGGAAACATAGGACTGGATCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145715.1-1401s21c1
Sequence:CCGGGCTGCATGAGAACCGTCAAATCTCGAGATTTGACGGTTCTCATGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145715.1-1495s21c1
Sequence:CCGGCAAGTCATAGACCAAGATTATCTCGAGATAATCTTGGTCTATGACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145715.1-206s21c1
Sequence:CCGGGCCTCACTCTGGGTGAAATAACTCGAGTTATTTCACCCAGAGTGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001145715
KPNA7 MISSION shRNA Lentiviral Transduction Particles
karyopherin alpha 7 (importin alpha 8)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000336961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145715.1-602s21c1
Sequence:CCGGCACATCTCCTAGCCTTGATTTCTCGAGAAATCAAGGCTAGGAGATGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145715.1-244s21c1
Sequence:CCGGTCAGATCCAGTCCTATGTTTCCTCGAGGAAACATAGGACTGGATCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145715.1-1401s21c1
Sequence:CCGGGCTGCATGAGAACCGTCAAATCTCGAGATTTGACGGTTCTCATGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145715.1-1495s21c1
Sequence:CCGGCAAGTCATAGACCAAGATTATCTCGAGATAATCTTGGTCTATGACTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145715.1-206s21c1
Sequence:CCGGGCCTCACTCTGGGTGAAATAACTCGAGTTATTTCACCCAGAGTGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)