EMAIL THIS PAGE TO A FRIEND

KPNB1

karyopherin (importin) beta 1

143 Gene Product Result for
Synonyms: IMB1 IPO1 IPOB Impnb NTF97
UniProtKB ID: Q14974, D3DTT3, Q14637, Q53XN2, Q96J27
Gene ID:
Human(3837) Summary: Nucleocytoplasmic transport, a signal- and energy-dependent process, takes place through nuclear pore complexes embedded in the nuclear envelope. The import of proteins containing a nuclear localization signal (NLS) requires the NLS import receptor, a heterodimer of importin alpha and beta subunits also known as karyopherins. Importin alpha binds the NLS-containing cargo in the cytoplasm and importin beta docks the complex at the cytoplasmic side of the nuclear pore complex. In the presence of nucleoside triphosphates and the small GTP binding protein Ran, the complex moves into the nuclear pore complex and the importin subunits dissociate. Importin alpha enters the nucleoplasm with its passenger protein and importin beta remains at the pore. Interactions between importin beta and the FG repeats of nucleoporins are essential in translocation through the pore complex. The protein encoded by this gene is a member of the importin beta family. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2013]
Mouse(16211) karyopherin (importin) beta 1
Rat(24917) karyopherin (importin) beta 1
domestic guinea pig(100723526) karyopherin (importin) beta 1
naked mole-rat(101726701) karyopherin (importin) beta 1
sheep(101118967) karyopherin (importin) beta 1
Domestic Rabbit(100353372) karyopherin (importin) beta 1
Zebrafish(570700) karyopherin (importin) beta 1
chicken(426499) karyopherin (importin) beta 1
dog(491042) karyopherin (importin) beta 1
domestic cat(101086517) karyopherin (importin) beta 1
Horse(100069121) karyopherin (importin) beta 1
cow(507804) karyopherin (importin) beta 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002265 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002265 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002265 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008379 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008379 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008379 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002265 Rosetta Predictions human pricing
NM_017063 Rosetta Predictions rat pricing
NM_008379 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002265 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00101673 predicted 1042
2 SASI_Hs02_00333523 predicted 2166
3 SASI_Hs01_00101674 predicted 2046
4 SASI_Hs02_00333524 predicted 1533
5 SASI_Hs01_00101678 predicted 2951
6 SASI_Hs01_00101679 predicted 903
7 SASI_Hs01_00101681 predicted 2693
8 SASI_Hs01_00101682 predicted 2582
9 SASI_Hs02_00333525 predicted 1318
10 SASI_Hs02_00333526 predicted 2152
11 SASI_Hs01_00101675 predicted 848
12 SASI_Hs01_00101676 predicted 2826
13 SASI_Hs01_00101677 predicted 546
14 SASI_Hs01_00101680 predicted 2866
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017063 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00108756 predicted 1680
2 SASI_Rn01_00108757 predicted 2281
3 SASI_Rn01_00108758 predicted 2343
4 SASI_Rn01_00108759 predicted 2581
5 SASI_Rn02_00261265 predicted 1076
6 SASI_Rn01_00108761 predicted 1191
7 SASI_Rn01_00108763 predicted 292
8 SASI_Rn01_00108764 predicted 787
9 SASI_Rn01_00108765 predicted 1882
10 SASI_Rn02_00261266 predicted 1294
11 SASI_Rn01_00108760 predicted 2675
12 SASI_Rn01_00108762 predicted 1843
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008379 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00172055 predicted 2131
2 SASI_Mm01_00172056 predicted 515
3 SASI_Mm01_00172058 predicted 1891
4 SASI_Mm02_00313743 predicted 803
5 SASI_Mm01_00172059 predicted 1000
6 SASI_Mm01_00172060 predicted 733
7 SASI_Mm01_00172061 predicted 2798
8 SASI_Mm01_00172062 predicted 1538
9 SASI_Mm02_00313744 predicted 621
10 SASI_Mm01_00172063 predicted 2803
11 SASI_Mm01_00172054 predicted 1511
12 SASI_Mm01_00172057 predicted 759
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002265
VALIDATED
KPNB1 MISSION shRNA Bacterial Glycerol Stock
karyopherin (importin) beta 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_002265.4-598s1c1
Sequence:CCGGCGACGAGAAGTCAAGAACTATCTCGAGATAGTTCTTGACTTCTCGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123189    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_002265.4-3152s1c1
Sequence:CCGGGCGCTGTTAGTGAGCTAAGTACTCGAGTACTTAGCTCACTAACAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_002265.4-1594s1c1
Sequence:CCGGCCCAGTGTAGTTGTTCGAGATCTCGAGATCTCGAACAACTACACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_002265.4-2887s1c1
Sequence:CCGGCGGAGATCGAAGACTAACAAACTCGAGTTTGTTAGTCTTCGATCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_002265.4-1595s1c1
Sequence:CCGGCCAGTGTAGTTGTTCGAGATACTCGAGTATCTCGAACAACTACACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_002265.4-2887s21c1
Sequence:CCGGCGGAGATCGAAGACTAACAAACTCGAGTTTGTTAGTCTTCGATCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290126    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_002265.4-3152s21c1
Sequence:CCGGGCGCTGTTAGTGAGCTAAGTACTCGAGTACTTAGCTCACTAACAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_002265.4-598s21c1
Sequence:CCGGCGACGAGAAGTCAAGAACTATCTCGAGATAGTTCTTGACTTCTCGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_002265.4-1595s21c1
Sequence:CCGGCCAGTGTAGTTGTTCGAGATACTCGAGTATCTCGAACAACTACACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002265.4-2477s21c1
Sequence:GTACCGGTGTCAGTGTTTGGTGATATTGCTCGAGCAATATCACCAAACACTGACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002265.4-882s21c1
Sequence:GTACCGGGAAAGAAGAGCCTAGTAATAACTCGAGTTATTACTAGGCTCTTCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002265.4-1559s21c1
Sequence:GTACCGGAGGCTATGCCCACCCTAATAGCTCGAGCTATTAGGGTGGGCATAGCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002265
VALIDATED
KPNB1 MISSION shRNA shRNA Plasmid DNA
karyopherin (importin) beta 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_002265.4-598s1c1
Sequence:CCGGCGACGAGAAGTCAAGAACTATCTCGAGATAGTTCTTGACTTCTCGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123189    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_002265.4-3152s1c1
Sequence:CCGGGCGCTGTTAGTGAGCTAAGTACTCGAGTACTTAGCTCACTAACAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_002265.4-1594s1c1
Sequence:CCGGCCCAGTGTAGTTGTTCGAGATCTCGAGATCTCGAACAACTACACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_002265.4-2887s1c1
Sequence:CCGGCGGAGATCGAAGACTAACAAACTCGAGTTTGTTAGTCTTCGATCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_002265.4-1595s1c1
Sequence:CCGGCCAGTGTAGTTGTTCGAGATACTCGAGTATCTCGAACAACTACACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_002265.4-2887s21c1
Sequence:CCGGCGGAGATCGAAGACTAACAAACTCGAGTTTGTTAGTCTTCGATCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290126    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_002265.4-3152s21c1
Sequence:CCGGGCGCTGTTAGTGAGCTAAGTACTCGAGTACTTAGCTCACTAACAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_002265.4-598s21c1
Sequence:CCGGCGACGAGAAGTCAAGAACTATCTCGAGATAGTTCTTGACTTCTCGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_002265.4-1595s21c1
Sequence:CCGGCCAGTGTAGTTGTTCGAGATACTCGAGTATCTCGAACAACTACACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002265.4-2477s21c1
Sequence:GTACCGGTGTCAGTGTTTGGTGATATTGCTCGAGCAATATCACCAAACACTGACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002265.4-882s21c1
Sequence:GTACCGGGAAAGAAGAGCCTAGTAATAACTCGAGTTATTACTAGGCTCTTCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002265.4-1559s21c1
Sequence:GTACCGGAGGCTATGCCCACCCTAATAGCTCGAGCTATTAGGGTGGGCATAGCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002265
VALIDATED
KPNB1 MISSION shRNA Lentiviral Transduction Particles
karyopherin (importin) beta 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_002265.4-598s1c1
Sequence:CCGGCGACGAGAAGTCAAGAACTATCTCGAGATAGTTCTTGACTTCTCGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123189    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_002265.4-3152s1c1
Sequence:CCGGGCGCTGTTAGTGAGCTAAGTACTCGAGTACTTAGCTCACTAACAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_002265.4-1594s1c1
Sequence:CCGGCCCAGTGTAGTTGTTCGAGATCTCGAGATCTCGAACAACTACACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_002265.4-2887s1c1
Sequence:CCGGCGGAGATCGAAGACTAACAAACTCGAGTTTGTTAGTCTTCGATCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_002265.4-1595s1c1
Sequence:CCGGCCAGTGTAGTTGTTCGAGATACTCGAGTATCTCGAACAACTACACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_002265.4-2887s21c1
Sequence:CCGGCGGAGATCGAAGACTAACAAACTCGAGTTTGTTAGTCTTCGATCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290126    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_002265.4-3152s21c1
Sequence:CCGGGCGCTGTTAGTGAGCTAAGTACTCGAGTACTTAGCTCACTAACAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_002265.4-598s21c1
Sequence:CCGGCGACGAGAAGTCAAGAACTATCTCGAGATAGTTCTTGACTTCTCGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_002265.4-1595s21c1
Sequence:CCGGCCAGTGTAGTTGTTCGAGATACTCGAGTATCTCGAACAACTACACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002265.4-2477s21c1
Sequence:GTACCGGTGTCAGTGTTTGGTGATATTGCTCGAGCAATATCACCAAACACTGACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002265.4-882s21c1
Sequence:GTACCGGGAAAGAAGAGCCTAGTAATAACTCGAGTTATTACTAGGCTCTTCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002265.4-1559s21c1
Sequence:GTACCGGAGGCTATGCCCACCCTAATAGCTCGAGCTATTAGGGTGGGCATAGCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008379
VALIDATED
KPNB1 MISSION shRNA Bacterial Glycerol Stock
karyopherin (importin) beta 1
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000112419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008379.2-1519s1c1
Sequence:CCGGCCACCTATTGTCTGTCTTCTTCTCGAGAAGAAGACAGACAATAGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008379.2-1229s1c1
Sequence:CCGGGCCTAATCAACTGAAACCATTCTCGAGAATGGTTTCAGTTGATTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008379.2-1265s1c1
Sequence:CCGGGCCCACCCTAATAGAACTAATCTCGAGATTAGTTCTATTAGGGTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008379.2-2078s1c1
Sequence:CCGGGCAGTCTAACATCTTGCCTTTCTCGAGAAAGGCAAGATGTTAGACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112415    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008379.2-2836s1c1
Sequence:CCGGGCGCTGTTAGACATGAGCTAACTCGAGTTAGCTCATGTCTAACAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008379.3-2559s21c1
Sequence:GTACCGGACTTTGACATGGTGGATTATCCTCGAGGATAATCCACCATGTCAAAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325923    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008379.3-3108s21c1
Sequence:CCGGGCGCTGTTAGACATGAGCTAACTCGAGTTAGCTCATGTCTAACAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008379.3-1501s21c1
Sequence:CCGGGCCTAATCAACTGAAACCATTCTCGAGAATGGTTTCAGTTGATTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008379.3-1791s21c1
Sequence:CCGGCCACCTATTGTCTGTCTTCTTCTCGAGAAGAAGACAGACAATAGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008379.3-1537s21c1
Sequence:CCGGGCCCACCCTAATAGAACTAATCTCGAGATTAGTTCTATTAGGGTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008379.3-1855s21c1
Sequence:GTACCGGACCCGATGGACACCAGAATAACTCGAGTTATTCTGGTGTCCATCGGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008379
VALIDATED
KPNB1 MISSION shRNA shRNA Plasmid DNA
karyopherin (importin) beta 1
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000112419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008379.2-1519s1c1
Sequence:CCGGCCACCTATTGTCTGTCTTCTTCTCGAGAAGAAGACAGACAATAGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008379.2-1229s1c1
Sequence:CCGGGCCTAATCAACTGAAACCATTCTCGAGAATGGTTTCAGTTGATTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008379.2-1265s1c1
Sequence:CCGGGCCCACCCTAATAGAACTAATCTCGAGATTAGTTCTATTAGGGTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008379.2-2078s1c1
Sequence:CCGGGCAGTCTAACATCTTGCCTTTCTCGAGAAAGGCAAGATGTTAGACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112415    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008379.2-2836s1c1
Sequence:CCGGGCGCTGTTAGACATGAGCTAACTCGAGTTAGCTCATGTCTAACAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008379.3-2559s21c1
Sequence:GTACCGGACTTTGACATGGTGGATTATCCTCGAGGATAATCCACCATGTCAAAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325923    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008379.3-3108s21c1
Sequence:CCGGGCGCTGTTAGACATGAGCTAACTCGAGTTAGCTCATGTCTAACAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008379.3-1501s21c1
Sequence:CCGGGCCTAATCAACTGAAACCATTCTCGAGAATGGTTTCAGTTGATTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008379.3-1791s21c1
Sequence:CCGGCCACCTATTGTCTGTCTTCTTCTCGAGAAGAAGACAGACAATAGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008379.3-1537s21c1
Sequence:CCGGGCCCACCCTAATAGAACTAATCTCGAGATTAGTTCTATTAGGGTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008379.3-1855s21c1
Sequence:GTACCGGACCCGATGGACACCAGAATAACTCGAGTTATTCTGGTGTCCATCGGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008379
VALIDATED
KPNB1 MISSION shRNA Lentiviral Transduction Particles
karyopherin (importin) beta 1
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000112419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008379.2-1519s1c1
Sequence:CCGGCCACCTATTGTCTGTCTTCTTCTCGAGAAGAAGACAGACAATAGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008379.2-1229s1c1
Sequence:CCGGGCCTAATCAACTGAAACCATTCTCGAGAATGGTTTCAGTTGATTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008379.2-1265s1c1
Sequence:CCGGGCCCACCCTAATAGAACTAATCTCGAGATTAGTTCTATTAGGGTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008379.2-2078s1c1
Sequence:CCGGGCAGTCTAACATCTTGCCTTTCTCGAGAAAGGCAAGATGTTAGACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112415    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008379.2-2836s1c1
Sequence:CCGGGCGCTGTTAGACATGAGCTAACTCGAGTTAGCTCATGTCTAACAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008379.3-2559s21c1
Sequence:GTACCGGACTTTGACATGGTGGATTATCCTCGAGGATAATCCACCATGTCAAAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325923    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008379.3-3108s21c1
Sequence:CCGGGCGCTGTTAGACATGAGCTAACTCGAGTTAGCTCATGTCTAACAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008379.3-1501s21c1
Sequence:CCGGGCCTAATCAACTGAAACCATTCTCGAGAATGGTTTCAGTTGATTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008379.3-1791s21c1
Sequence:CCGGCCACCTATTGTCTGTCTTCTTCTCGAGAAGAAGACAGACAATAGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008379.3-1537s21c1
Sequence:CCGGGCCCACCCTAATAGAACTAATCTCGAGATTAGTTCTATTAGGGTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008379.3-1855s21c1
Sequence:GTACCGGACCCGATGGACACCAGAATAACTCGAGTTATTCTGGTGTCCATCGGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)