EMAIL THIS PAGE TO A FRIEND

KPRP

keratinocyte proline-rich protein

110 Gene Product Result for
Synonyms: C1orf45
UniProtKB ID: Q5T749
Gene ID:
Mouse(433619) keratinocyte expressed, proline-rich
Rat(432393) keratinocyte proline-rich protein
domestic cat(101088350) keratinocyte proline-rich protein
cow(100140143) keratinocyte proline-rich protein
sheep(101121142) keratinocyte proline-rich protein
domestic guinea pig(100730788) keratinocyte proline-rich protein
naked mole-rat(101724555) keratinocyte proline-rich protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001025231 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001025231 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001025231 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028629 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028629 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028629 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001025231 Rosetta Predictions human pricing
NM_001002290 Rosetta Predictions rat pricing
NM_028629 Rosetta Predictions mouse pricing
XM_001000620 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025231 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00307420 predicted 1214
2 SASI_Hs02_00307421 predicted 636
3 SASI_Hs01_00065736 predicted 439
4 SASI_Hs01_00065737 predicted 600
5 SASI_Hs01_00065739 predicted 903
6 SASI_Hs01_00065740 predicted 444
7 SASI_Hs01_00065741 predicted 427
8 SASI_Hs01_00065742 predicted 213
9 SASI_Hs02_00307422 predicted 673
10 SASI_Hs01_00065744 predicted 1594
11 SASI_Hs01_00065735 predicted 358
12 SASI_Hs01_00065738 predicted 1894
13 SASI_Hs01_00065743 predicted 588
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002290 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00073545 predicted 2081
2 SASI_Rn01_00073546 predicted 2161
3 SASI_Rn01_00073547 predicted 315
4 SASI_Rn02_00197979 predicted 982
5 SASI_Rn01_00073548 predicted 2149
6 SASI_Rn01_00073549 predicted 1133
7 SASI_Rn01_00073550 predicted 2194
8 SASI_Rn01_00073551 predicted 879
9 SASI_Rn01_00073552 predicted 891
10 SASI_Rn01_00073553 predicted 574
11 SASI_Rn01_00073554 predicted 458
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028629 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00334144 predicted 1016
2 SASI_Mm02_00334145 predicted 2052
3 SASI_Mm02_00334146 predicted 2046
4 SASI_Mm02_00334147 predicted 278
5 SASI_Mm02_00334148 predicted 2107
6 SASI_Mm02_00334149 predicted 1965
7 SASI_Mm02_00334150 predicted 1170
8 SASI_Mm02_00334151 predicted 1810
9 SASI_Mm02_00334152 predicted 730
10 SASI_Mm02_00334153 predicted 659
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001000620 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00208028 predicted 230
2 SASI_Mm01_00208029 predicted 166
3 SASI_Mm01_00208030 predicted 258
4 SASI_Mm01_00208031 predicted 79
5 SASI_Mm01_00208032 predicted 122
6 SASI_Mm01_00208033 predicted 93
7 SASI_Mm01_00208034 predicted 29
8 SASI_Mm01_00208035 predicted 94
9 SASI_Mm01_00208036 predicted 104
10 SASI_Mm01_00208037 predicted 90
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001025231
KPRP MISSION shRNA Bacterial Glycerol Stock
keratinocyte proline-rich protein
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025231.1-719s21c1
Sequence:CCGGTATCGGTCCCGGACTTCATTTCTCGAGAAATGAAGTCCGGGACCGATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025231.1-1026s21c1
Sequence:CCGGCCAAGTGCCGAATCGAGATTTCTCGAGAAATCTCGATTCGGCACTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025231.1-442s21c1
Sequence:CCGGTCAGACTTGCTTCGTAGAATGCTCGAGCATTCTACGAAGCAAGTCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262511    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001025231.1-1896s21c1
Sequence:CCGGATATTCAGAGACTCCCTATTACTCGAGTAATAGGGAGTCTCTGAATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025231.1-953s21c1
Sequence:CCGGCGCCGCTCTGAACCCATATATCTCGAGATATATGGGTTCAGAGCGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183550    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025231.1-1343s1c1
Sequence:CCGGGAACCTTGTTTGTATCCAGAACTCGAGTTCTGGATACAAACAAGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180064    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025231.1-429s1c1
Sequence:CCGGCGTCACAACCTGTTCAGACTTCTCGAGAAGTCTGAACAGGTTGTGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001025231
KPRP MISSION shRNA shRNA Plasmid DNA
keratinocyte proline-rich protein
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025231.1-719s21c1
Sequence:CCGGTATCGGTCCCGGACTTCATTTCTCGAGAAATGAAGTCCGGGACCGATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025231.1-1026s21c1
Sequence:CCGGCCAAGTGCCGAATCGAGATTTCTCGAGAAATCTCGATTCGGCACTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025231.1-442s21c1
Sequence:CCGGTCAGACTTGCTTCGTAGAATGCTCGAGCATTCTACGAAGCAAGTCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262511    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001025231.1-1896s21c1
Sequence:CCGGATATTCAGAGACTCCCTATTACTCGAGTAATAGGGAGTCTCTGAATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025231.1-953s21c1
Sequence:CCGGCGCCGCTCTGAACCCATATATCTCGAGATATATGGGTTCAGAGCGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183550    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025231.1-1343s1c1
Sequence:CCGGGAACCTTGTTTGTATCCAGAACTCGAGTTCTGGATACAAACAAGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180064    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025231.1-429s1c1
Sequence:CCGGCGTCACAACCTGTTCAGACTTCTCGAGAAGTCTGAACAGGTTGTGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001025231
KPRP MISSION shRNA Lentiviral Transduction Particles
keratinocyte proline-rich protein
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025231.1-719s21c1
Sequence:CCGGTATCGGTCCCGGACTTCATTTCTCGAGAAATGAAGTCCGGGACCGATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025231.1-1026s21c1
Sequence:CCGGCCAAGTGCCGAATCGAGATTTCTCGAGAAATCTCGATTCGGCACTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025231.1-442s21c1
Sequence:CCGGTCAGACTTGCTTCGTAGAATGCTCGAGCATTCTACGAAGCAAGTCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262511    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001025231.1-1896s21c1
Sequence:CCGGATATTCAGAGACTCCCTATTACTCGAGTAATAGGGAGTCTCTGAATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025231.1-953s21c1
Sequence:CCGGCGCCGCTCTGAACCCATATATCTCGAGATATATGGGTTCAGAGCGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183550    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025231.1-1343s1c1
Sequence:CCGGGAACCTTGTTTGTATCCAGAACTCGAGTTCTGGATACAAACAAGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180064    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025231.1-429s1c1
Sequence:CCGGCGTCACAACCTGTTCAGACTTCTCGAGAAGTCTGAACAGGTTGTGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028629
KPRP MISSION shRNA Bacterial Glycerol Stock
keratinocyte proline-rich protein
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000254574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028629.1-491s21c1
Sequence:CCGGTACTATACAGAGACTCGTTATCTCGAGATAACGAGTCTCTGTATAGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028629.1-452s21c1
Sequence:CCGGCAACCTCCTCAGACCTATTATCTCGAGATAATAGGTCTGAGGAGGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028629.1-1542s21c1
Sequence:CCGGCTCGCCCATGTCCTCCATTAACTCGAGTTAATGGAGGACATGGGCGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254575    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028629.1-2489s21c1
Sequence:CCGGTTTCAACACTCTCGAATTATTCTCGAGAATAATTCGAGAGTGTTGAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028629.1-427s21c1
Sequence:CCGGTCAGGTTTCCTACGTGCAAATCTCGAGATTTGCACGTAGGAAACCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028629
KPRP MISSION shRNA shRNA Plasmid DNA
keratinocyte proline-rich protein
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000254574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028629.1-491s21c1
Sequence:CCGGTACTATACAGAGACTCGTTATCTCGAGATAACGAGTCTCTGTATAGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028629.1-452s21c1
Sequence:CCGGCAACCTCCTCAGACCTATTATCTCGAGATAATAGGTCTGAGGAGGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028629.1-1542s21c1
Sequence:CCGGCTCGCCCATGTCCTCCATTAACTCGAGTTAATGGAGGACATGGGCGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254575    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028629.1-2489s21c1
Sequence:CCGGTTTCAACACTCTCGAATTATTCTCGAGAATAATTCGAGAGTGTTGAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028629.1-427s21c1
Sequence:CCGGTCAGGTTTCCTACGTGCAAATCTCGAGATTTGCACGTAGGAAACCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028629
KPRP MISSION shRNA Lentiviral Transduction Particles
keratinocyte proline-rich protein
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000254574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028629.1-491s21c1
Sequence:CCGGTACTATACAGAGACTCGTTATCTCGAGATAACGAGTCTCTGTATAGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028629.1-452s21c1
Sequence:CCGGCAACCTCCTCAGACCTATTATCTCGAGATAATAGGTCTGAGGAGGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028629.1-1542s21c1
Sequence:CCGGCTCGCCCATGTCCTCCATTAACTCGAGTTAATGGAGGACATGGGCGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254575    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028629.1-2489s21c1
Sequence:CCGGTTTCAACACTCTCGAATTATTCTCGAGAATAATTCGAGAGTGTTGAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028629.1-427s21c1
Sequence:CCGGTCAGGTTTCCTACGTGCAAATCTCGAGATTTGCACGTAGGAAACCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)