EMAIL THIS PAGE TO A FRIEND

KRAS

Kirsten rat sarcoma viral oncogene homolog

217 Gene Product Result for
Synonyms: C-K-RAS CFC2 K-RAS2A K-RAS2B K-RAS4A K-RAS4B KI-RAS KRAS1 KRAS2 NS NS3 RASK2
UniProtKB ID: P01116, A8K8Z5, B0LPF9, P01118, Q96D10
Gene ID:
Human(3845) Summary: This gene, a Kirsten ras oncogene homolog from the mammalian ras gene family, encodes a protein that is a member of the small GTPase superfamily. A single amino acid substitution is responsible for an activating mutation. The transforming protein that results is implicated in various malignancies, including lung adenocarcinoma, mucinous adenoma, ductal carcinoma of the pancreas and colorectal carcinoma. Alternative splicing leads to variants encoding two isoforms that differ in the C-terminal region. [provided by RefSeq, Jul 2008]
Mouse(16653) v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog
Rat(24525) Kirsten rat sarcoma viral oncogene
Zebrafish(445289) v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog
cow(541140) v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog
dog(403871) v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog
chicken(418207) v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog
sheep(101114005) v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog
domestic guinea pig(100716262) v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog
naked mole-rat(101718997) v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108685 Anti-KRAS affinity isolated antibody mouse, mouse, rabbit, human, zebrafish, horse, bovine, rat, canine, guinea pig
western blot pricing
SAB2701821 Anti-kras antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
western blot pricing
SAB2101297 Anti-KRAS antibody produced in rabbit affinity isolated antibody guinea pig, rat, human, horse, mouse, rabbit
western blot pricing
HPA049830 Anti-KRAS antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB2107115 Anti-KRAS antibody produced in rabbit affinity isolated antibody guinea pig, horse, rabbit, human, rat
western blot pricing
SAB1305747 ANTI-KRAS2(C-TERMINAL) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human
western blot pricing
R3400 Monoclonal Anti-c-K-Ras antibody produced in mouse clone 234-4.2, purified immunoglobulin, buffered aqueous solution mouse, human, rat
immunohistochemistry, immunoprecipitation (IP), western blot pricing
WH0003845M1 Monoclonal Anti-KRAS antibody produced in mouse clone 3B10-2F2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1404011 Monoclonal Anti-KRAS antibody produced in mouse clone 4F3, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB4100599 Monoclonal Anti-KRAS antibody produced in mouse clone KRAS-A582, culture supernatant human
western blot pricing
SAB4100600 Monoclonal Anti-KRAS antibody produced in mouse clone KRAS-B582, culture supernatant human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033360 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033360 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033360 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021284 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021284 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021284 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004985 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004985 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004985 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU114431 MISSION® esiRNA esiRNA human KRAS (esiRNA1) human pricing

Related Products

Product # Description Species Add to Cart
 
MABS194 Anti-c-K-Ras Antibody, clone 234-4.2 This Anti-c-K-Ras Antibody, clone 234-4.2 is validated for use in Western Blotting, IHC for the detection of c-K-Ras. pricing
ABC1442 Anti-K-Ras4A Antibody, Isoform-specific Detect K-Ras4A using this rabbit polyclonal Anti-K-Ras4A Antibody, Cat. No. ABC1442, validated for use in Western Blotting. pricing
MABS195 Anti-Pan-Ras Antibody, clone RAS 10 Detect Pan-Ras using this Anti-Pan-Ras Antibody, clone RAS 10 validated for use in Western Blotting, ICC. pricing
05-516 Anti-Ras Antibody, clone RAS10 Detect Ras using this Anti-Ras Antibody, clone RAS10 validated for use in ELISA, FC, IC, IH, IP & WB. pricing
05-516-AF555 Anti-Ras Antibody, clone RAS10, Alexa Fluor® 555 Conjugate Detect Ras using this mouse monoclonal Anti-Ras Antibody, clone RAS10, Alexa Fluor® 555 Conjugate, Cat. No. 05-516-AF555, validated for use in Flow Cytometry aned Immunocytochemistry. pricing
05-516-AF647 Anti-Ras Antibody, clone RAS10, Alexa Fluor® 647 Conjugate Detect Ras using this mouse monoclonal Anti-Ras Antibody, clone RAS10, Alexa Fluor® 647 Conjugate, Cat. No. 05-516-AF647, validated for use in Flow Cytometry aned Immunocytochemistry. pricing
05-1072 Anti-Ras Antibody, (K-, H-, N-), clone 9A11.2 This Anti-Ras Antibody, (K-, H-, N-), clone 9A11.2 is validated for use in WB, IH(P) for the detection of Ras. pricing
FCMAB148F Anti-Ras -FITC Antibody, clone RAS10 Anti-Ras -FITC Antibody, clone RAS10 is an antibody against Ras for use in FC. pricing
16-321 Anti-Ras Magnetic Bead Conjugate Antibody Anti-Ras Magnetic Bead Conjugate Antibody detects level of Ras Magnetic Bead Conjugate & has been published & validated for use in WB & IP. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004985 Rosetta Predictions human pricing
NM_033360 Rosetta Predictions human pricing
NM_031515 Rosetta Predictions rat pricing
NM_021284 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004985 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00202557 predicted 328
2 SASI_Hs01_00202556 predicted 366
3 SASI_Hs01_00202558 predicted 235
4 SASI_Hs02_00338697 predicted 454
5 SASI_Hs01_00202559 predicted 770
6 SASI_Hs01_00202560 predicted 534
7 SASI_Hs01_00202561 predicted 462
8 SASI_Hs01_00202563 predicted 625
9 SASI_Hs01_00202564 predicted 482
10 SASI_Hs02_00338698 predicted 236
11 SASI_Hs01_00202562 predicted 411
12 SASI_Hs01_00202565 predicted 515
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033360 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00082296 predicted 323
2 SASI_Hs01_00082294 predicted 367
3 SASI_Hs01_00082295 predicted 749
4 SASI_Hs01_00082297 predicted 751
5 SASI_Hs01_00082298 predicted 242
6 SASI_Hs01_00082299 predicted 460
7 SASI_Hs01_00082300 predicted 539
8 SASI_Hs01_00082301 predicted 462
9 SASI_Hs01_00082303 predicted 482
10 SASI_Hs02_00361210 predicted 234
11 SASI_Hs01_00082302 predicted 411
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031515 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00052849 predicted 231
2 SASI_Rn01_00052850 predicted 230
3 SASI_Rn01_00052851 predicted 236
4 SASI_Rn01_00052852 predicted 237
5 SASI_Rn01_00052853 predicted 248
6 SASI_Rn01_00052854 predicted 232
7 SASI_Rn01_00052856 predicted 248
8 SASI_Rn01_00052857 predicted 244
9 SASI_Rn02_00264641 predicted 240
10 SASI_Rn02_00264642 predicted 200
11 SASI_Rn01_00052848 predicted 226
12 SASI_Rn01_00052855 predicted 256
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021284 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00165654 predicted 333
2 SASI_Mm01_00165655 predicted 384
3 SASI_Mm01_00165656 predicted 566
4 SASI_Mm01_00165657 predicted 341
5 SASI_Mm01_00165658 predicted 536
6 SASI_Mm01_00165659 predicted 471
7 SASI_Mm01_00165660 predicted 749
8 SASI_Mm01_00165661 predicted 474
9 SASI_Mm01_00165662 predicted 428
10 SASI_Mm01_00165663 predicted 530
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033360
VALIDATED
KRAS MISSION shRNA Bacterial Glycerol Stock
Kirsten rat sarcoma viral oncogene homolog
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033360.2-234s21c1
Sequence:CCGGCCTTGACGATACAGCTAATTCCTCGAGGAATTAGCTGTATCGTCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033360.2-451s21c1
Sequence:CCGGTGAAGATATTCACCATTATAGCTCGAGCTATAATGGTGAATATCTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033360.2-509s21c1
Sequence:CCGGCCTATGGTCCTAGTAGGAAATCTCGAGATTTCCTACTAGGACCATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352609    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033360.2-1273s21c1
Sequence:CCGGCAGTTGAGACCTTCTAATTGGCTCGAGCCAATTAGAAGGTCTCAACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033360.2-407s21c1
Sequence:CCGGGAGGGCTTTCTTTGTGTATTTCTCGAGAAATACACAAAGAAAGCCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033360.2-269s1c1
Sequence:CCGGGACGAATATGATCCAACAATACTCGAGTATTGTTGGATCATATTCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_033360.2-407s1c1
Sequence:CCGGGAGGGCTTTCTTTGTGTATTTCTCGAGAAATACACAAAGAAAGCCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_033360.2-509s1c1
Sequence:CCGGCCTATGGTCCTAGTAGGAAATCTCGAGATTTCCTACTAGGACCATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_033360.2-667s1c1
Sequence:CCGGGATCCGACAATACAGATTGAACTCGAGTTCAATCTGTATTGTCGGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033259    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_033360.2-4328s1c1
Sequence:CCGGGCAGACGTATATTGTATCATTCTCGAGAATGATACAATATACGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033360
VALIDATED
KRAS MISSION shRNA shRNA Plasmid DNA
Kirsten rat sarcoma viral oncogene homolog
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033360.2-234s21c1
Sequence:CCGGCCTTGACGATACAGCTAATTCCTCGAGGAATTAGCTGTATCGTCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033360.2-451s21c1
Sequence:CCGGTGAAGATATTCACCATTATAGCTCGAGCTATAATGGTGAATATCTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033360.2-509s21c1
Sequence:CCGGCCTATGGTCCTAGTAGGAAATCTCGAGATTTCCTACTAGGACCATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352609    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033360.2-1273s21c1
Sequence:CCGGCAGTTGAGACCTTCTAATTGGCTCGAGCCAATTAGAAGGTCTCAACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033360.2-407s21c1
Sequence:CCGGGAGGGCTTTCTTTGTGTATTTCTCGAGAAATACACAAAGAAAGCCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033360.2-269s1c1
Sequence:CCGGGACGAATATGATCCAACAATACTCGAGTATTGTTGGATCATATTCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_033360.2-407s1c1
Sequence:CCGGGAGGGCTTTCTTTGTGTATTTCTCGAGAAATACACAAAGAAAGCCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_033360.2-509s1c1
Sequence:CCGGCCTATGGTCCTAGTAGGAAATCTCGAGATTTCCTACTAGGACCATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_033360.2-667s1c1
Sequence:CCGGGATCCGACAATACAGATTGAACTCGAGTTCAATCTGTATTGTCGGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033259    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_033360.2-4328s1c1
Sequence:CCGGGCAGACGTATATTGTATCATTCTCGAGAATGATACAATATACGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033360
VALIDATED
KRAS MISSION shRNA Lentiviral Transduction Particles
Kirsten rat sarcoma viral oncogene homolog
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033360.2-234s21c1
Sequence:CCGGCCTTGACGATACAGCTAATTCCTCGAGGAATTAGCTGTATCGTCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033360.2-451s21c1
Sequence:CCGGTGAAGATATTCACCATTATAGCTCGAGCTATAATGGTGAATATCTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033360.2-509s21c1
Sequence:CCGGCCTATGGTCCTAGTAGGAAATCTCGAGATTTCCTACTAGGACCATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352609    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033360.2-1273s21c1
Sequence:CCGGCAGTTGAGACCTTCTAATTGGCTCGAGCCAATTAGAAGGTCTCAACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033360.2-407s21c1
Sequence:CCGGGAGGGCTTTCTTTGTGTATTTCTCGAGAAATACACAAAGAAAGCCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033360.2-269s1c1
Sequence:CCGGGACGAATATGATCCAACAATACTCGAGTATTGTTGGATCATATTCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_033360.2-407s1c1
Sequence:CCGGGAGGGCTTTCTTTGTGTATTTCTCGAGAAATACACAAAGAAAGCCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_033360.2-509s1c1
Sequence:CCGGCCTATGGTCCTAGTAGGAAATCTCGAGATTTCCTACTAGGACCATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_033360.2-667s1c1
Sequence:CCGGGATCCGACAATACAGATTGAACTCGAGTTCAATCTGTATTGTCGGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033259    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_033360.2-4328s1c1
Sequence:CCGGGCAGACGTATATTGTATCATTCTCGAGAATGATACAATATACGTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021284
VALIDATED
KRAS MISSION shRNA Bacterial Glycerol Stock
Kirsten rat sarcoma viral oncogene homolog
Mouse
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000301869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021284.5-319s21c1
Sequence:CCGGCAAGTAGTAATTGATGGAGAACTCGAGTTCTCCATCAATTACTACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021284.5-660s21c1
Sequence:CCGGCTATACATTAGTCCGAGAAATCTCGAGATTTCTCGGACTAATGTATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021284.5-581s21c1
Sequence:CCGGCTCAGGAGTTAGCAAGGAGTTCTCGAGAACTCCTTGCTAACTCCTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021284.5-699s21c1
Sequence:CCGGGATGAGCAAAGATGGGAAGAACTCGAGTTCTTCCCATCTTTGCTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021284.5-644s21c1
Sequence:CCGGGTGTTGACGATGCCTTCTATACTCGAGTATAGAAGGCATCGTCAACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021284.2-270s1c1
Sequence:CCGGGATGAGTACGACCCTACGATACTCGAGTATCGTAGGGTCGTACTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021284.2-510s1c1
Sequence:CCGGCCTATGGTCCTGGTAGGGAATCTCGAGATTCCCTACCAGGACCATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021284.2-634s1c1
Sequence:CCGGGTGTTGACGATGCCTTCTATACTCGAGTATAGAAGGCATCGTCAACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021284.2-325s1c1
Sequence:CCGGGAGAAACCTGTCTCTTGGATACTCGAGTATCCAAGAGACAGGTTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021284.2-234s1c1
Sequence:CCGGGCCTTGACGATACAGCTAATTCTCGAGAATTAGCTGTATCGTCAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021284.2-571s1c1
Sequence:CCGGCTCAGGAGTTAGCAAGGAGTTCTCGAGAACTCCTTGCTAACTCCTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021284.2-689s1c1
Sequence:CCGGGATGAGCAAAGATGGGAAGAACTCGAGTTCTTCCCATCTTTGCTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021284.2-298s1c1
Sequence:CCGGCCTACAGGAAACAAGTAGTAACTCGAGTTACTACTTGTTTCCTGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021284.2-650s1c1
Sequence:CCGGCTATACATTAGTCCGAGAAATCTCGAGATTTCTCGGACTAATGTATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021284
VALIDATED
KRAS MISSION shRNA shRNA Plasmid DNA
Kirsten rat sarcoma viral oncogene homolog
Mouse
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000301869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021284.5-319s21c1
Sequence:CCGGCAAGTAGTAATTGATGGAGAACTCGAGTTCTCCATCAATTACTACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021284.5-660s21c1
Sequence:CCGGCTATACATTAGTCCGAGAAATCTCGAGATTTCTCGGACTAATGTATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021284.5-581s21c1
Sequence:CCGGCTCAGGAGTTAGCAAGGAGTTCTCGAGAACTCCTTGCTAACTCCTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021284.5-699s21c1
Sequence:CCGGGATGAGCAAAGATGGGAAGAACTCGAGTTCTTCCCATCTTTGCTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021284.5-644s21c1
Sequence:CCGGGTGTTGACGATGCCTTCTATACTCGAGTATAGAAGGCATCGTCAACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021284.2-270s1c1
Sequence:CCGGGATGAGTACGACCCTACGATACTCGAGTATCGTAGGGTCGTACTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021284.2-510s1c1
Sequence:CCGGCCTATGGTCCTGGTAGGGAATCTCGAGATTCCCTACCAGGACCATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021284.2-634s1c1
Sequence:CCGGGTGTTGACGATGCCTTCTATACTCGAGTATAGAAGGCATCGTCAACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021284.2-325s1c1
Sequence:CCGGGAGAAACCTGTCTCTTGGATACTCGAGTATCCAAGAGACAGGTTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021284.2-234s1c1
Sequence:CCGGGCCTTGACGATACAGCTAATTCTCGAGAATTAGCTGTATCGTCAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021284.2-571s1c1
Sequence:CCGGCTCAGGAGTTAGCAAGGAGTTCTCGAGAACTCCTTGCTAACTCCTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021284.2-689s1c1
Sequence:CCGGGATGAGCAAAGATGGGAAGAACTCGAGTTCTTCCCATCTTTGCTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021284.2-298s1c1
Sequence:CCGGCCTACAGGAAACAAGTAGTAACTCGAGTTACTACTTGTTTCCTGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021284.2-650s1c1
Sequence:CCGGCTATACATTAGTCCGAGAAATCTCGAGATTTCTCGGACTAATGTATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021284
VALIDATED
KRAS MISSION shRNA Lentiviral Transduction Particles
Kirsten rat sarcoma viral oncogene homolog
Mouse
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000301869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021284.5-319s21c1
Sequence:CCGGCAAGTAGTAATTGATGGAGAACTCGAGTTCTCCATCAATTACTACTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021284.5-660s21c1
Sequence:CCGGCTATACATTAGTCCGAGAAATCTCGAGATTTCTCGGACTAATGTATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021284.5-581s21c1
Sequence:CCGGCTCAGGAGTTAGCAAGGAGTTCTCGAGAACTCCTTGCTAACTCCTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021284.5-699s21c1
Sequence:CCGGGATGAGCAAAGATGGGAAGAACTCGAGTTCTTCCCATCTTTGCTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021284.5-644s21c1
Sequence:CCGGGTGTTGACGATGCCTTCTATACTCGAGTATAGAAGGCATCGTCAACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021284.2-270s1c1
Sequence:CCGGGATGAGTACGACCCTACGATACTCGAGTATCGTAGGGTCGTACTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021284.2-510s1c1
Sequence:CCGGCCTATGGTCCTGGTAGGGAATCTCGAGATTCCCTACCAGGACCATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021284.2-634s1c1
Sequence:CCGGGTGTTGACGATGCCTTCTATACTCGAGTATAGAAGGCATCGTCAACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021284.2-325s1c1
Sequence:CCGGGAGAAACCTGTCTCTTGGATACTCGAGTATCCAAGAGACAGGTTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021284.2-234s1c1
Sequence:CCGGGCCTTGACGATACAGCTAATTCTCGAGAATTAGCTGTATCGTCAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021284.2-571s1c1
Sequence:CCGGCTCAGGAGTTAGCAAGGAGTTCTCGAGAACTCCTTGCTAACTCCTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021284.2-689s1c1
Sequence:CCGGGATGAGCAAAGATGGGAAGAACTCGAGTTCTTCCCATCTTTGCTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021284.2-298s1c1
Sequence:CCGGCCTACAGGAAACAAGTAGTAACTCGAGTTACTACTTGTTTCCTGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021284.2-650s1c1
Sequence:CCGGCTATACATTAGTCCGAGAAATCTCGAGATTTCTCGGACTAATGTATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004985
VALIDATED
KRAS MISSION shRNA Bacterial Glycerol Stock
Kirsten rat sarcoma viral oncogene homolog
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000040152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_004985.3-492s1c1
Sequence:CCGGAGGACTCTGAAGATGTACCTACTCGAGTAGGTACATCTTCAGAGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004985.3-297s1c1
Sequence:CCGGCCTACAGGAAGCAAGTAGTAACTCGAGTTACTACTTGCTTCCTGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_004985.3-641s1c1
Sequence:CCGGGATGCCTTCTATACATTAGTTCTCGAGAACTAATGTATAGAAGGCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040148    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_004985.3-3896s1c1
Sequence:CCGGCCTCGTTTCTACACAGAGAAACTCGAGTTTCTCTGTGTAGAAACGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010369    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_004985.x-1160s1c1
Sequence:CCGGCAGTTGAGACCTTCTAATTGGCTCGAGCCAATTAGAAGGTCTCAACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004985.x-204s1c1
Sequence:CCGGTAGTTGGAGCTGGTGGCGTAGCTCGAGCTACGCCACCAGCTCCAACTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004985
VALIDATED
KRAS MISSION shRNA shRNA Plasmid DNA
Kirsten rat sarcoma viral oncogene homolog
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000040152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_004985.3-492s1c1
Sequence:CCGGAGGACTCTGAAGATGTACCTACTCGAGTAGGTACATCTTCAGAGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004985.3-297s1c1
Sequence:CCGGCCTACAGGAAGCAAGTAGTAACTCGAGTTACTACTTGCTTCCTGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_004985.3-641s1c1
Sequence:CCGGGATGCCTTCTATACATTAGTTCTCGAGAACTAATGTATAGAAGGCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040148    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_004985.3-3896s1c1
Sequence:CCGGCCTCGTTTCTACACAGAGAAACTCGAGTTTCTCTGTGTAGAAACGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010369    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_004985.x-1160s1c1
Sequence:CCGGCAGTTGAGACCTTCTAATTGGCTCGAGCCAATTAGAAGGTCTCAACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004985.x-204s1c1
Sequence:CCGGTAGTTGGAGCTGGTGGCGTAGCTCGAGCTACGCCACCAGCTCCAACTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004985
VALIDATED
KRAS MISSION shRNA Lentiviral Transduction Particles
Kirsten rat sarcoma viral oncogene homolog
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000040152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_004985.3-492s1c1
Sequence:CCGGAGGACTCTGAAGATGTACCTACTCGAGTAGGTACATCTTCAGAGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004985.3-297s1c1
Sequence:CCGGCCTACAGGAAGCAAGTAGTAACTCGAGTTACTACTTGCTTCCTGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_004985.3-641s1c1
Sequence:CCGGGATGCCTTCTATACATTAGTTCTCGAGAACTAATGTATAGAAGGCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040148    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_004985.3-3896s1c1
Sequence:CCGGCCTCGTTTCTACACAGAGAAACTCGAGTTTCTCTGTGTAGAAACGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010369    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_004985.x-1160s1c1
Sequence:CCGGCAGTTGAGACCTTCTAATTGGCTCGAGCCAATTAGAAGGTCTCAACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004985.x-204s1c1
Sequence:CCGGTAGTTGGAGCTGGTGGCGTAGCTCGAGCTACGCCACCAGCTCCAACTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)