EMAIL THIS PAGE TO A FRIEND

KRBA1

KRAB-A domain containing 1

140 Gene Product Result for
UniProtKB ID: A5PL33, A7E2F5, E7ENE9, Q8N4X0, Q96JG5
Gene ID:
Mouse(77827) KRAB-A domain containing 1
Rat(362358) KRAB-A domain containing 1
dog(610822) KRAB-A domain containing 1
domestic cat(101092347) KRAB-A domain containing 1
cow(512939) KRAB-A domain containing 1
sheep(101108383) KRAB-A domain containing 1
Domestic Rabbit(100346839) KRAB-A domain containing 1
domestic guinea pig(100730634) KRAB-A domain containing 1
naked mole-rat(101722022) KRAB-A domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032534 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032534 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032534 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133922 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133922 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133922 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU133191 MISSION® esiRNA esiRNA human KRBA1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032534 Rosetta Predictions human pricing
XM_001053983 Rosetta Predictions rat pricing
XM_342681 Rosetta Predictions rat pricing
NM_133922 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032534 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00228512 predicted 3698
2 SASI_Hs01_00228513 predicted 1643
3 SASI_Hs01_00228514 predicted 3581
4 SASI_Hs02_00360043 predicted 466
5 SASI_Hs01_00228515 predicted 1700
6 SASI_Hs01_00228516 predicted 978
7 SASI_Hs02_00360044 predicted 2562
8 SASI_Hs01_00228519 predicted 1640
9 SASI_Hs01_00228520 predicted 1908
10 SASI_Hs02_00360045 predicted 3196
11 SASI_Hs01_00228517 predicted 2637
12 SASI_Hs01_00228518 predicted 605
13 SASI_Hs01_00228521 predicted 1648
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053983 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00274222 predicted 1021
2 SASI_Rn02_00274223 predicted 517
3 SASI_Rn02_00274224 predicted 2052
4 SASI_Rn02_00274225 predicted 1139
5 SASI_Rn02_00274226 predicted 3543
6 SASI_Rn02_00274227 predicted 785
7 SASI_Rn02_00274228 predicted 772
8 SASI_Rn02_00274229 predicted 931
9 SASI_Rn02_00274230 predicted 1653
10 SASI_Rn02_00274231 predicted 3236
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342681 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00394661 predicted 1026
2 SASI_Rn02_00394662 predicted 525
3 SASI_Rn02_00394663 predicted 2049
4 SASI_Rn02_00394664 predicted 1137
5 SASI_Rn02_00394665 predicted 3544
6 SASI_Rn02_00394666 predicted 785
7 SASI_Rn02_00394667 predicted 771
8 SASI_Rn02_00394668 predicted 931
9 SASI_Rn02_00394669 predicted 1651
10 SASI_Rn02_00394670 predicted 3235
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133922 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00339008 predicted 535
2 SASI_Mm01_00070493 predicted 936
3 SASI_Mm01_00070494 predicted 963
4 SASI_Mm01_00070495 predicted 534
5 SASI_Mm01_00070496 predicted 782
6 SASI_Mm01_00070497 predicted 795
7 SASI_Mm01_00070499 predicted 1290
8 SASI_Mm01_00070500 predicted 2867
9 SASI_Mm01_00070501 predicted 508
10 SASI_Mm01_00070502 predicted 769
11 SASI_Mm01_00070498 predicted 846
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032534
KRBA1 MISSION shRNA Bacterial Glycerol Stock
KRAB-A domain containing 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000131196    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032534.1-3495s1c1
Sequence:CCGGGCATTCCTCTTCTCCACATCTCTCGAGAGATGTGGAGAAGAGGAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032534.1-1685s1c1
Sequence:CCGGGATCACACAGTGAAGAAGCGACTCGAGTCGCTTCTTCACTGTGTGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032534.1-3039s1c1
Sequence:CCGGCACGAGGCCTAAACCAAAGATCTCGAGATCTTTGGTTTAGGCCTCGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032534.1-1030s1c1
Sequence:CCGGCTCATCAACTGTCTGAAGGAACTCGAGTTCCTTCAGACAGTTGATGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032534.1-603s1c1
Sequence:CCGGGAAGGAGATCCCAGAGTTCTTCTCGAGAAGAACTCTGGGATCTCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032534.2-3287s21c1
Sequence:CCGGCTTTAGTGCCTGCTGCCTTACCTCGAGGTAAGGCAGCAGGCACTAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032534
KRBA1 MISSION shRNA shRNA Plasmid DNA
KRAB-A domain containing 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000131196    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032534.1-3495s1c1
Sequence:CCGGGCATTCCTCTTCTCCACATCTCTCGAGAGATGTGGAGAAGAGGAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032534.1-1685s1c1
Sequence:CCGGGATCACACAGTGAAGAAGCGACTCGAGTCGCTTCTTCACTGTGTGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032534.1-3039s1c1
Sequence:CCGGCACGAGGCCTAAACCAAAGATCTCGAGATCTTTGGTTTAGGCCTCGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032534.1-1030s1c1
Sequence:CCGGCTCATCAACTGTCTGAAGGAACTCGAGTTCCTTCAGACAGTTGATGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032534.1-603s1c1
Sequence:CCGGGAAGGAGATCCCAGAGTTCTTCTCGAGAAGAACTCTGGGATCTCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032534.2-3287s21c1
Sequence:CCGGCTTTAGTGCCTGCTGCCTTACCTCGAGGTAAGGCAGCAGGCACTAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032534
KRBA1 MISSION shRNA Lentiviral Transduction Particles
KRAB-A domain containing 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000131196    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032534.1-3495s1c1
Sequence:CCGGGCATTCCTCTTCTCCACATCTCTCGAGAGATGTGGAGAAGAGGAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032534.1-1685s1c1
Sequence:CCGGGATCACACAGTGAAGAAGCGACTCGAGTCGCTTCTTCACTGTGTGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032534.1-3039s1c1
Sequence:CCGGCACGAGGCCTAAACCAAAGATCTCGAGATCTTTGGTTTAGGCCTCGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032534.1-1030s1c1
Sequence:CCGGCTCATCAACTGTCTGAAGGAACTCGAGTTCCTTCAGACAGTTGATGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032534.1-603s1c1
Sequence:CCGGGAAGGAGATCCCAGAGTTCTTCTCGAGAAGAACTCTGGGATCTCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032534.2-3287s21c1
Sequence:CCGGCTTTAGTGCCTGCTGCCTTACCTCGAGGTAAGGCAGCAGGCACTAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133922
KRBA1 MISSION shRNA Bacterial Glycerol Stock
KRAB-A domain containing 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000184755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133922.2-2877s1c1
Sequence:CCGGCCCAAATGGATCAACTGCGAACTCGAGTTCGCAGTTGATCCATTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133922.2-2241s1c1
Sequence:CCGGGCTCTGATGGAGAAGACCTAACTCGAGTTAGGTCTTCTCCATCAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133922.2-3126s1c1
Sequence:CCGGCAGAGGCTTCCTTGGTAGAATCTCGAGATTCTACCAAGGAAGCCTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182973    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133922.2-3831s1c1
Sequence:CCGGCCTGATCTCAAGAACACTAAACTCGAGTTTAGTGTTCTTGAGATCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183190    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133922.2-3563s1c1
Sequence:CCGGGTATCTTCCTTCTTACCTGTTCTCGAGAACAGGTAAGAAGGAAGATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133922
KRBA1 MISSION shRNA shRNA Plasmid DNA
KRAB-A domain containing 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000184755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133922.2-2877s1c1
Sequence:CCGGCCCAAATGGATCAACTGCGAACTCGAGTTCGCAGTTGATCCATTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133922.2-2241s1c1
Sequence:CCGGGCTCTGATGGAGAAGACCTAACTCGAGTTAGGTCTTCTCCATCAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133922.2-3126s1c1
Sequence:CCGGCAGAGGCTTCCTTGGTAGAATCTCGAGATTCTACCAAGGAAGCCTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182973    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133922.2-3831s1c1
Sequence:CCGGCCTGATCTCAAGAACACTAAACTCGAGTTTAGTGTTCTTGAGATCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183190    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133922.2-3563s1c1
Sequence:CCGGGTATCTTCCTTCTTACCTGTTCTCGAGAACAGGTAAGAAGGAAGATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133922
KRBA1 MISSION shRNA Lentiviral Transduction Particles
KRAB-A domain containing 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000184755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133922.2-2877s1c1
Sequence:CCGGCCCAAATGGATCAACTGCGAACTCGAGTTCGCAGTTGATCCATTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133922.2-2241s1c1
Sequence:CCGGGCTCTGATGGAGAAGACCTAACTCGAGTTAGGTCTTCTCCATCAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133922.2-3126s1c1
Sequence:CCGGCAGAGGCTTCCTTGGTAGAATCTCGAGATTCTACCAAGGAAGCCTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182973    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133922.2-3831s1c1
Sequence:CCGGCCTGATCTCAAGAACACTAAACTCGAGTTTAGTGTTCTTGAGATCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183190    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133922.2-3563s1c1
Sequence:CCGGGTATCTTCCTTCTTACCTGTTCTCGAGAACAGGTAAGAAGGAAGATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)