EMAIL THIS PAGE TO A FRIEND

KRBA2

KRAB-A domain containing 2

29 Gene Product Result for
UniProtKB ID: Q6ZNG9, Q8IYY0
Gene ID:
sheep(101108063) KRAB-A domain containing 2
domestic cat(101081584) KRAB-A domain containing 2
cow(530088) KRAB-A domain containing 2
Horse(100073064) KRAB-A domain containing 2
dog(100682842) KRAB-A domain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_213597 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_213597 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_213597 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU047931 MISSION® esiRNA esiRNA human KRBA2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_213597 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_213597 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00092787 predicted 1246
2 SASI_Hs01_00092788 predicted 340
3 SASI_Hs01_00092790 predicted 1142
4 SASI_Hs01_00092791 predicted 723
5 SASI_Hs01_00092792 predicted 1378
6 SASI_Hs02_00374271 predicted 449
7 SASI_Hs01_00092793 predicted 1030
8 SASI_Hs01_00092794 predicted 1186
9 SASI_Hs01_00092796 predicted 489
10 SASI_Hs02_00374272 predicted 1166
11 SASI_Hs01_00092789 predicted 559
12 SASI_Hs01_00092795 predicted 1287
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_213597
KRBA2 MISSION shRNA Bacterial Glycerol Stock
KRAB-A domain containing 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_213597.2-923s21c1
Sequence:CCGGTCAGTGTCTTGTTAGATATTTCTCGAGAAATATCTAACAAGACACTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_213597.2-143s21c1
Sequence:CCGGTGACCAAAGATTGGAATTATTCTCGAGAATAATTCCAATCTTTGGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213597.1-554s1c1
Sequence:CCGGCGAATACGGTATTATGTACATCTCGAGATGTACATAATACCGTATTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213597.1-1232s1c1
Sequence:CCGGGAGGCAATGTTTGGCTATAAACTCGAGTTTATAGCCAAACATTGCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160176    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_213597.1-1529s1c1
Sequence:CCGGCATAGTCATCTGAGAACTGTTCTCGAGAACAGTTCTCAGATGACTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213597.1-796s1c1
Sequence:CCGGCCAAGTTGAAATACTTGACATCTCGAGATGTCAAGTATTTCAACTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213597.1-548s1c1
Sequence:CCGGCGTGATCGAATACGGTATTATCTCGAGATAATACCGTATTCGATCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213597.1-1183s1c1
Sequence:CCGGGATGGTGAGGAATCAGGCTTTCTCGAGAAAGCCTGATTCCTCACCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213597.1-294s1c1
Sequence:CCGGCAAATGCAAGTGAAATGGAAACTCGAGTTTCCATTTCACTTGCATTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160515    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_213597.1-1635s1c1
Sequence:CCGGCAGGTCTGTGTATTTATTCTTCTCGAGAAGAATAAATACACAGACCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_213597.2-453s21c1
Sequence:CCGGGAAGAAGTCATCACGTGATTACTCGAGTAATCACGTGATGACTTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_213597
KRBA2 MISSION shRNA shRNA Plasmid DNA
KRAB-A domain containing 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_213597.2-923s21c1
Sequence:CCGGTCAGTGTCTTGTTAGATATTTCTCGAGAAATATCTAACAAGACACTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_213597.2-143s21c1
Sequence:CCGGTGACCAAAGATTGGAATTATTCTCGAGAATAATTCCAATCTTTGGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213597.1-554s1c1
Sequence:CCGGCGAATACGGTATTATGTACATCTCGAGATGTACATAATACCGTATTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213597.1-1232s1c1
Sequence:CCGGGAGGCAATGTTTGGCTATAAACTCGAGTTTATAGCCAAACATTGCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160176    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_213597.1-1529s1c1
Sequence:CCGGCATAGTCATCTGAGAACTGTTCTCGAGAACAGTTCTCAGATGACTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213597.1-796s1c1
Sequence:CCGGCCAAGTTGAAATACTTGACATCTCGAGATGTCAAGTATTTCAACTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213597.1-548s1c1
Sequence:CCGGCGTGATCGAATACGGTATTATCTCGAGATAATACCGTATTCGATCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213597.1-1183s1c1
Sequence:CCGGGATGGTGAGGAATCAGGCTTTCTCGAGAAAGCCTGATTCCTCACCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213597.1-294s1c1
Sequence:CCGGCAAATGCAAGTGAAATGGAAACTCGAGTTTCCATTTCACTTGCATTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160515    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_213597.1-1635s1c1
Sequence:CCGGCAGGTCTGTGTATTTATTCTTCTCGAGAAGAATAAATACACAGACCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_213597.2-453s21c1
Sequence:CCGGGAAGAAGTCATCACGTGATTACTCGAGTAATCACGTGATGACTTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_213597
KRBA2 MISSION shRNA Lentiviral Transduction Particles
KRAB-A domain containing 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_213597.2-923s21c1
Sequence:CCGGTCAGTGTCTTGTTAGATATTTCTCGAGAAATATCTAACAAGACACTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_213597.2-143s21c1
Sequence:CCGGTGACCAAAGATTGGAATTATTCTCGAGAATAATTCCAATCTTTGGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213597.1-554s1c1
Sequence:CCGGCGAATACGGTATTATGTACATCTCGAGATGTACATAATACCGTATTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213597.1-1232s1c1
Sequence:CCGGGAGGCAATGTTTGGCTATAAACTCGAGTTTATAGCCAAACATTGCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160176    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_213597.1-1529s1c1
Sequence:CCGGCATAGTCATCTGAGAACTGTTCTCGAGAACAGTTCTCAGATGACTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213597.1-796s1c1
Sequence:CCGGCCAAGTTGAAATACTTGACATCTCGAGATGTCAAGTATTTCAACTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213597.1-548s1c1
Sequence:CCGGCGTGATCGAATACGGTATTATCTCGAGATAATACCGTATTCGATCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213597.1-1183s1c1
Sequence:CCGGGATGGTGAGGAATCAGGCTTTCTCGAGAAAGCCTGATTCCTCACCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213597.1-294s1c1
Sequence:CCGGCAAATGCAAGTGAAATGGAAACTCGAGTTTCCATTTCACTTGCATTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160515    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_213597.1-1635s1c1
Sequence:CCGGCAGGTCTGTGTATTTATTCTTCTCGAGAAGAATAAATACACAGACCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_213597.2-453s21c1
Sequence:CCGGGAAGAAGTCATCACGTGATTACTCGAGTAATCACGTGATGACTTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)