EMAIL THIS PAGE TO A FRIEND

KRBOX4

KRAB box domain containing 4

35 Gene Product Result for
Synonyms: ZNF673
Species: Human KRBOX4(55634)
UniProtKB ID: Q5JUW0, A8K0Y8, B3KU22, Q96EA3, Q9NXB1
Gene ID:
Human(55634) Summary: This encodes a zinc finger protein with an N-terminal KRAB (Kruppel-associated) domain found in transcriptional repressors. This gene is located in a region of the X chromosome thought to be involved in nonsyndromic X-linked mental retardation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302408 ANTI-ZN673 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017776 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017776 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017776 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017776 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017776 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00241650 predicted 535
2 SASI_Hs01_00241648 predicted 301
3 SASI_Hs01_00241649 predicted 403
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017776
KRBOX4 MISSION shRNA Bacterial Glycerol Stock
KRAB box domain containing 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000018205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017776.1-535s1c1
Sequence:CCGGGCATTTATCTGAGCACAGAATCTCGAGATTCTGTGCTCAGATAAATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017776.1-505s1c1
Sequence:CCGGGCGGTCAAGAATCCAGAACATCTCGAGATGTTCTGGATTCTTGACCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017776.1-323s1c1
Sequence:CCGGGCCTGATGTGATCTTCAGGTTCTCGAGAACCTGAAGATCACATCAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017776.1-547s1c1
Sequence:CCGGGCACAGAATTTGATTCTGTAACTCGAGTTACAGAATCAAATTCTGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017776.1-446s1c1
Sequence:CCGGCCAAGACAAACTTCCTTGGCACTCGAGTGCCAAGGAAGTTTGTCTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017776.2-488s21c1
Sequence:CCGGTGAAGAGTCCTGGATGGCAGACTCGAGTCTGCCATCCAGGACTCTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017776.2-451s21c1
Sequence:CCGGTTGCGAAGCCAGATGTGATCTCTCGAGAGATCACATCTGGCTTCGCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017776.2-533s21c1
Sequence:CCGGTGCAGAAGTCTGGCAAGTTGACTCGAGTCAACTTGCCAGACTTCTGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017776.2-331s21c1
Sequence:CCGGAGGACGTGTTTGTGGACTTCACTCGAGTGAAGTCCACAAACACGTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017776.2-628s21c1
Sequence:CCGGTGAAGGATGAAAGCGGTCAAGCTCGAGCTTGACCGCTTTCATCCTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017776
KRBOX4 MISSION shRNA shRNA Plasmid DNA
KRAB box domain containing 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000018205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017776.1-535s1c1
Sequence:CCGGGCATTTATCTGAGCACAGAATCTCGAGATTCTGTGCTCAGATAAATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017776.1-505s1c1
Sequence:CCGGGCGGTCAAGAATCCAGAACATCTCGAGATGTTCTGGATTCTTGACCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017776.1-323s1c1
Sequence:CCGGGCCTGATGTGATCTTCAGGTTCTCGAGAACCTGAAGATCACATCAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017776.1-547s1c1
Sequence:CCGGGCACAGAATTTGATTCTGTAACTCGAGTTACAGAATCAAATTCTGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017776.1-446s1c1
Sequence:CCGGCCAAGACAAACTTCCTTGGCACTCGAGTGCCAAGGAAGTTTGTCTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017776.2-488s21c1
Sequence:CCGGTGAAGAGTCCTGGATGGCAGACTCGAGTCTGCCATCCAGGACTCTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017776.2-451s21c1
Sequence:CCGGTTGCGAAGCCAGATGTGATCTCTCGAGAGATCACATCTGGCTTCGCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017776.2-533s21c1
Sequence:CCGGTGCAGAAGTCTGGCAAGTTGACTCGAGTCAACTTGCCAGACTTCTGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017776.2-331s21c1
Sequence:CCGGAGGACGTGTTTGTGGACTTCACTCGAGTGAAGTCCACAAACACGTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017776.2-628s21c1
Sequence:CCGGTGAAGGATGAAAGCGGTCAAGCTCGAGCTTGACCGCTTTCATCCTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017776
KRBOX4 MISSION shRNA Lentiviral Transduction Particles
KRAB box domain containing 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000018205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017776.1-535s1c1
Sequence:CCGGGCATTTATCTGAGCACAGAATCTCGAGATTCTGTGCTCAGATAAATGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017776.1-505s1c1
Sequence:CCGGGCGGTCAAGAATCCAGAACATCTCGAGATGTTCTGGATTCTTGACCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017776.1-323s1c1
Sequence:CCGGGCCTGATGTGATCTTCAGGTTCTCGAGAACCTGAAGATCACATCAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017776.1-547s1c1
Sequence:CCGGGCACAGAATTTGATTCTGTAACTCGAGTTACAGAATCAAATTCTGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017776.1-446s1c1
Sequence:CCGGCCAAGACAAACTTCCTTGGCACTCGAGTGCCAAGGAAGTTTGTCTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017776.2-488s21c1
Sequence:CCGGTGAAGAGTCCTGGATGGCAGACTCGAGTCTGCCATCCAGGACTCTTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017776.2-451s21c1
Sequence:CCGGTTGCGAAGCCAGATGTGATCTCTCGAGAGATCACATCTGGCTTCGCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017776.2-533s21c1
Sequence:CCGGTGCAGAAGTCTGGCAAGTTGACTCGAGTCAACTTGCCAGACTTCTGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017776.2-331s21c1
Sequence:CCGGAGGACGTGTTTGTGGACTTCACTCGAGTGAAGTCCACAAACACGTCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017776.2-628s21c1
Sequence:CCGGTGAAGGATGAAAGCGGTCAAGCTCGAGCTTGACCGCTTTCATCCTTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)