EMAIL THIS PAGE TO A FRIEND

KRCC1

lysine-rich coiled-coil 1

84 Gene Product Result for
Synonyms: CHBP2
UniProtKB ID: Q9NPI7, Q3B7J7
Gene ID:
Mouse(57896) lysine-rich coiled-coil 1
Rat(312437) lysine-rich coiled-coil 1
domestic cat(101094752) lysine-rich coiled-coil 1
cow(507166) lysine-rich coiled-coil 1
dog(475759) lysine-rich coiled-coil 1
sheep(101108468) lysine-rich coiled-coil 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016618 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016618 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016618 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145568 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145568 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145568 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU085611 MISSION® esiRNA esiRNA human KRCC1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016618 Rosetta Predictions human pricing
NM_001009413 Rosetta Predictions rat pricing
NM_145568 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016618 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00181201 predicted 533
2 SASI_Hs01_00181202 predicted 1488
3 SASI_Hs01_00181203 predicted 548
4 SASI_Hs01_00181204 predicted 1514
5 SASI_Hs01_00181205 predicted 1279
6 SASI_Hs01_00181206 predicted 1293
7 SASI_Hs01_00181207 predicted 617
8 SASI_Hs01_00181208 predicted 673
9 SASI_Hs02_00349770 predicted 1292
10 SASI_Hs01_00181210 predicted 1386
11 SASI_Hs01_00181209 predicted 439
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009413 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00053720 predicted 577
2 SASI_Rn01_00053721 predicted 461
3 SASI_Rn01_00053722 predicted 1140
4 SASI_Rn01_00053723 predicted 573
5 SASI_Rn01_00053724 predicted 570
6 SASI_Rn01_00053725 predicted 450
7 SASI_Rn01_00053726 predicted 630
8 SASI_Rn01_00053727 predicted 367
9 SASI_Rn01_00053728 predicted 433
10 SASI_Rn01_00053729 predicted 335
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145568 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00058248 predicted 750
2 SASI_Mm01_00058249 predicted 496
3 SASI_Mm01_00058250 predicted 619
4 SASI_Mm01_00058251 predicted 758
5 SASI_Mm01_00058252 predicted 556
6 SASI_Mm01_00058255 predicted 454
7 SASI_Mm02_00341077 predicted 640
8 SASI_Mm01_00058257 predicted 691
9 SASI_Mm02_00341078 predicted 448
10 SASI_Mm02_00341079 predicted 770
11 SASI_Mm01_00058253 predicted 1155
12 SASI_Mm01_00058254 predicted 1280
13 SASI_Mm01_00058256 predicted 1014
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016618
VALIDATED
KRCC1 MISSION shRNA Bacterial Glycerol Stock
lysine-rich coiled-coil 1
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000343766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016618.1-805s21c1
Sequence:CCGGCAAGCACTTCTCCTCAGATAACTCGAGTTATCTGAGGAGAAGTGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016618.1-998s21c1
Sequence:CCGGGTGGAAATAGAAACCGTACATCTCGAGATGTACGGTTTCTATTTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343770    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016618.1-1498s21c1
Sequence:CCGGCCTTTGCACAATCTGTTTCTTCTCGAGAAGAAACAGATTGTGCAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016618.1-1151s21c1
Sequence:CCGGGACCAGTCTATTCTTGGATTTCTCGAGAAATCCAAGAATAGACTGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_016618.1-916s1c1
Sequence:CCGGGCGGTCTAAGCATAAGAGAAACTCGAGTTTCTCTTATGCTTAGACCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_016618.1-805s1c1
Sequence:CCGGCAAGCACTTCTCCTCAGATAACTCGAGTTATCTGAGGAGAAGTGCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140007    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016618.1-682s1c1
Sequence:CCGGGAGACTAGACTCTCTGAGCTACTCGAGTAGCTCAGAGAGTCTAGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016618.1-601s1c1
Sequence:CCGGGACCTACCCAAGATCATGCAACTCGAGTTGCATGATCTTGGGTAGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016618.1-603s1c1
Sequence:CCGGCCTACCCAAGATCATGCAATACTCGAGTATTGCATGATCTTGGGTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016618.1-1033s1c1
Sequence:CCGGGCTTAAGAATCGAAAGGAGAACTCGAGTTCTCCTTTCGATTCTTAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_016618.1-1151s1c1
Sequence:CCGGGACCAGTCTATTCTTGGATTTCTCGAGAAATCCAAGAATAGACTGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144251    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016618.1-1430s1c1
Sequence:CCGGCAAATTGCTTTGATGGTGGAACTCGAGTTCCACCATCAAAGCAATTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144361    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016618.1-1498s1c1
Sequence:CCGGCCTTTGCACAATCTGTTTCTTCTCGAGAAGAAACAGATTGTGCAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016618.1-998s1c1
Sequence:CCGGGTGGAAATAGAAACCGTACATCTCGAGATGTACGGTTTCTATTTCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016618
VALIDATED
KRCC1 MISSION shRNA shRNA Plasmid DNA
lysine-rich coiled-coil 1
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000343766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016618.1-805s21c1
Sequence:CCGGCAAGCACTTCTCCTCAGATAACTCGAGTTATCTGAGGAGAAGTGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016618.1-998s21c1
Sequence:CCGGGTGGAAATAGAAACCGTACATCTCGAGATGTACGGTTTCTATTTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343770    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016618.1-1498s21c1
Sequence:CCGGCCTTTGCACAATCTGTTTCTTCTCGAGAAGAAACAGATTGTGCAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016618.1-1151s21c1
Sequence:CCGGGACCAGTCTATTCTTGGATTTCTCGAGAAATCCAAGAATAGACTGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_016618.1-916s1c1
Sequence:CCGGGCGGTCTAAGCATAAGAGAAACTCGAGTTTCTCTTATGCTTAGACCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_016618.1-805s1c1
Sequence:CCGGCAAGCACTTCTCCTCAGATAACTCGAGTTATCTGAGGAGAAGTGCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140007    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016618.1-682s1c1
Sequence:CCGGGAGACTAGACTCTCTGAGCTACTCGAGTAGCTCAGAGAGTCTAGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016618.1-601s1c1
Sequence:CCGGGACCTACCCAAGATCATGCAACTCGAGTTGCATGATCTTGGGTAGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016618.1-603s1c1
Sequence:CCGGCCTACCCAAGATCATGCAATACTCGAGTATTGCATGATCTTGGGTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016618.1-1033s1c1
Sequence:CCGGGCTTAAGAATCGAAAGGAGAACTCGAGTTCTCCTTTCGATTCTTAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_016618.1-1151s1c1
Sequence:CCGGGACCAGTCTATTCTTGGATTTCTCGAGAAATCCAAGAATAGACTGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144251    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016618.1-1430s1c1
Sequence:CCGGCAAATTGCTTTGATGGTGGAACTCGAGTTCCACCATCAAAGCAATTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144361    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016618.1-1498s1c1
Sequence:CCGGCCTTTGCACAATCTGTTTCTTCTCGAGAAGAAACAGATTGTGCAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016618.1-998s1c1
Sequence:CCGGGTGGAAATAGAAACCGTACATCTCGAGATGTACGGTTTCTATTTCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016618
VALIDATED
KRCC1 MISSION shRNA Lentiviral Transduction Particles
lysine-rich coiled-coil 1
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000343766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016618.1-805s21c1
Sequence:CCGGCAAGCACTTCTCCTCAGATAACTCGAGTTATCTGAGGAGAAGTGCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016618.1-998s21c1
Sequence:CCGGGTGGAAATAGAAACCGTACATCTCGAGATGTACGGTTTCTATTTCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343770    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016618.1-1498s21c1
Sequence:CCGGCCTTTGCACAATCTGTTTCTTCTCGAGAAGAAACAGATTGTGCAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016618.1-1151s21c1
Sequence:CCGGGACCAGTCTATTCTTGGATTTCTCGAGAAATCCAAGAATAGACTGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_016618.1-916s1c1
Sequence:CCGGGCGGTCTAAGCATAAGAGAAACTCGAGTTTCTCTTATGCTTAGACCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_016618.1-805s1c1
Sequence:CCGGCAAGCACTTCTCCTCAGATAACTCGAGTTATCTGAGGAGAAGTGCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140007    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016618.1-682s1c1
Sequence:CCGGGAGACTAGACTCTCTGAGCTACTCGAGTAGCTCAGAGAGTCTAGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016618.1-601s1c1
Sequence:CCGGGACCTACCCAAGATCATGCAACTCGAGTTGCATGATCTTGGGTAGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016618.1-603s1c1
Sequence:CCGGCCTACCCAAGATCATGCAATACTCGAGTATTGCATGATCTTGGGTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016618.1-1033s1c1
Sequence:CCGGGCTTAAGAATCGAAAGGAGAACTCGAGTTCTCCTTTCGATTCTTAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_016618.1-1151s1c1
Sequence:CCGGGACCAGTCTATTCTTGGATTTCTCGAGAAATCCAAGAATAGACTGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144251    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016618.1-1430s1c1
Sequence:CCGGCAAATTGCTTTGATGGTGGAACTCGAGTTCCACCATCAAAGCAATTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144361    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016618.1-1498s1c1
Sequence:CCGGCCTTTGCACAATCTGTTTCTTCTCGAGAAGAAACAGATTGTGCAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016618.1-998s1c1
Sequence:CCGGGTGGAAATAGAAACCGTACATCTCGAGATGTACGGTTTCTATTTCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145568
KRCC1 MISSION shRNA Bacterial Glycerol Stock
lysine-rich coiled-coil 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000248463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145568.3-856s21c1
Sequence:CCGGTCAAGTCAGTCATAGACAAATCTCGAGATTTGTCTATGACTGACTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145568.3-781s21c1
Sequence:CCGGATACAATTGTGGCTCATATAGCTCGAGCTATATGAGCCACAATTGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216463    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145568.3-1163s1c1
Sequence:CCGGGACCAGTCTATTCTTGGATTTCTCGAGAAATCCAAGAATAGACTGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145568.3-1070s21c1
Sequence:CCGGACCCGAGATGTATCATCTAAGCTCGAGCTTAGATGATACATCTCGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145568.3-678s21c1
Sequence:CCGGTACCAGCTCATGACAAGATAACTCGAGTTATCTTGTCATGAGCTGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248462    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145568.3-1433s21c1
Sequence:CCGGGCTGTGGTAGTGGACTTATTTCTCGAGAAATAAGTCCACTACCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192658    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145568.3-1433s1c1
Sequence:CCGGGCTGTGGTAGTGGACTTATTTCTCGAGAAATAAGTCCACTACCACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191799    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145568.3-1246s1c1
Sequence:CCGGGCATTCATATTCATGTCACTTCTCGAGAAGTGACATGAATATGAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192230    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145568.3-854s1c1
Sequence:CCGGCCTCAAGTCAGTCATAGACAACTCGAGTTGTCTATGACTGACTTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145568
KRCC1 MISSION shRNA shRNA Plasmid DNA
lysine-rich coiled-coil 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000248463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145568.3-856s21c1
Sequence:CCGGTCAAGTCAGTCATAGACAAATCTCGAGATTTGTCTATGACTGACTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145568.3-781s21c1
Sequence:CCGGATACAATTGTGGCTCATATAGCTCGAGCTATATGAGCCACAATTGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216463    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145568.3-1163s1c1
Sequence:CCGGGACCAGTCTATTCTTGGATTTCTCGAGAAATCCAAGAATAGACTGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145568.3-1070s21c1
Sequence:CCGGACCCGAGATGTATCATCTAAGCTCGAGCTTAGATGATACATCTCGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145568.3-678s21c1
Sequence:CCGGTACCAGCTCATGACAAGATAACTCGAGTTATCTTGTCATGAGCTGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248462    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145568.3-1433s21c1
Sequence:CCGGGCTGTGGTAGTGGACTTATTTCTCGAGAAATAAGTCCACTACCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192658    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145568.3-1433s1c1
Sequence:CCGGGCTGTGGTAGTGGACTTATTTCTCGAGAAATAAGTCCACTACCACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191799    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145568.3-1246s1c1
Sequence:CCGGGCATTCATATTCATGTCACTTCTCGAGAAGTGACATGAATATGAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192230    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145568.3-854s1c1
Sequence:CCGGCCTCAAGTCAGTCATAGACAACTCGAGTTGTCTATGACTGACTTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145568
KRCC1 MISSION shRNA Lentiviral Transduction Particles
lysine-rich coiled-coil 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000248463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145568.3-856s21c1
Sequence:CCGGTCAAGTCAGTCATAGACAAATCTCGAGATTTGTCTATGACTGACTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145568.3-781s21c1
Sequence:CCGGATACAATTGTGGCTCATATAGCTCGAGCTATATGAGCCACAATTGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216463    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145568.3-1163s1c1
Sequence:CCGGGACCAGTCTATTCTTGGATTTCTCGAGAAATCCAAGAATAGACTGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145568.3-1070s21c1
Sequence:CCGGACCCGAGATGTATCATCTAAGCTCGAGCTTAGATGATACATCTCGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145568.3-678s21c1
Sequence:CCGGTACCAGCTCATGACAAGATAACTCGAGTTATCTTGTCATGAGCTGGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248462    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145568.3-1433s21c1
Sequence:CCGGGCTGTGGTAGTGGACTTATTTCTCGAGAAATAAGTCCACTACCACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192658    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145568.3-1433s1c1
Sequence:CCGGGCTGTGGTAGTGGACTTATTTCTCGAGAAATAAGTCCACTACCACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191799    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145568.3-1246s1c1
Sequence:CCGGGCATTCATATTCATGTCACTTCTCGAGAAGTGACATGAATATGAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192230    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145568.3-854s1c1
Sequence:CCGGCCTCAAGTCAGTCATAGACAACTCGAGTTGTCTATGACTGACTTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)