EMAIL THIS PAGE TO A FRIEND

KREMEN1

kringle containing transmembrane protein 1

154 Gene Product Result for
Synonyms: KREMEN KRM1
Gene ID:
Human(83999) Summary: This gene encodes a high-affinity dickkopf homolog 1 (DKK1) transmembrane receptor that functionally cooperates with DKK1 to block wingless (WNT)/beta-catenin signaling. The encoded protein is a component of a membrane complex that modulates canonical WNT signaling through lipoprotein receptor-related protein 6 (LRP6). It contains extracellular kringle, WSC, and CUB domains. Alternatively spliced transcript variants encoding distinct isoforms have been observed for this gene. [provided by RefSeq, Jul 2008]
Mouse(84035) kringle containing transmembrane protein 1
Rat(114107) kringle containing transmembrane protein 1
sheep(101120442) kringle containing transmembrane protein 1
Domestic Rabbit(100356147) kringle containing transmembrane protein 1
domestic guinea pig(100726601) kringle containing transmembrane protein 1
naked mole-rat(101724863) kringle containing transmembrane protein 1
Zebrafish(100141352) kringle containing transmembrane protein 1
chicken(416920) kringle containing transmembrane protein 1
dog(486340) kringle containing transmembrane protein 1
domestic cat(101092648) kringle containing transmembrane protein 1
cow(524357) kringle containing transmembrane protein 1
Horse(100064476) kringle containing transmembrane protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB0819 Mouse Kremen1 / Kremen Protein 1 ELISA Kit mouse pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032045 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032045 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032045 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_032396 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_032396 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_032396 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU072231 MISSION® esiRNA esiRNA targeting mouse Kremen1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039570 Rosetta Predictions human pricing
NM_001039571 Rosetta Predictions human pricing
NM_153379 Rosetta Predictions human pricing
NM_053649 Rosetta Predictions rat pricing
NM_032396 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039570 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00051239 predicted 882
2 SASI_Hs01_00051240 predicted 404
3 SASI_Hs01_00051241 predicted 401
4 SASI_Hs01_00051242 predicted 426
5 SASI_Hs01_00051243 predicted 443
6 SASI_Hs01_00051244 predicted 365
7 SASI_Hs02_00308564 predicted 210
8 SASI_Hs01_00051245 predicted 675
9 SASI_Hs01_00051248 predicted 1644
10 SASI_Hs02_00308565 predicted 341
11 SASI_Hs01_00051246 predicted 1815
12 SASI_Hs01_00051247 predicted 1810
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039571 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00206692 predicted 881
2 SASI_Hs01_00206693 predicted 409
3 SASI_Hs01_00206694 predicted 409
4 SASI_Hs01_00206695 predicted 432
5 SASI_Hs01_00206696 predicted 443
6 SASI_Hs01_00206697 predicted 359
7 SASI_Hs02_00308566 predicted 203
8 SASI_Hs01_00206698 predicted 676
9 SASI_Hs01_00206701 predicted 1587
10 SASI_Hs02_00308567 predicted 337
11 SASI_Hs01_00206699 predicted 1762
12 SASI_Hs01_00206700 predicted 1762
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153379 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00116450 predicted 889
2 SASI_Hs01_00116451 predicted 401
3 SASI_Hs01_00116452 predicted 408
4 SASI_Hs01_00116453 predicted 427
5 SASI_Hs01_00116454 predicted 440
6 SASI_Hs01_00116455 predicted 359
7 SASI_Hs01_00116456 predicted 677
8 SASI_Hs01_00116457 predicted 1803
9 SASI_Hs01_00116458 predicted 1797
10 SASI_Hs01_00116459 predicted 1641
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053649 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00096099 predicted 1356
2 SASI_Rn01_00096100 predicted 1343
3 SASI_Rn01_00096101 predicted 944
4 SASI_Rn01_00096102 predicted 1393
5 SASI_Rn01_00096103 predicted 422
6 SASI_Rn01_00096104 predicted 1260
7 SASI_Rn01_00096105 predicted 362
8 SASI_Rn01_00096106 predicted 762
9 SASI_Rn01_00096107 predicted 787
10 SASI_Rn01_00096108 predicted 333
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032396 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00195375 predicted 1387
2 SASI_Mm01_00195376 predicted 497
3 SASI_Mm01_00195377 predicted 1015
4 SASI_Mm01_00195378 predicted 1433
5 SASI_Mm01_00195379 predicted 272
6 SASI_Mm01_00195380 predicted 426
7 SASI_Mm02_00337240 predicted 1310
8 SASI_Mm01_00195381 predicted 1415
9 SASI_Mm02_00337241 predicted 1425
10 SASI_Mm01_00195383 predicted 759
11 SASI_Mm01_00195382 predicted 856
12 SASI_Mm01_00195384 predicted 843
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032045
VALIDATED
KREMEN1 MISSION shRNA Bacterial Glycerol Stock
kringle containing transmembrane protein 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032045.3-434s1c1
Sequence:CCGGTCCAACAAACTCACCATACAACTCGAGTTGTATGGTGAGTTTGTTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074098    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032045.3-1739s1c1
Sequence:CCGGCGTCTCTAAGAATAGAAAGAACTCGAGTTCTTTCTATTCTTAGAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032045.3-624s1c1
Sequence:CCGGGCAGGATCATCCTCTTTGATACTCGAGTATCAAAGAGGATGATCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032045.3-447s1c1
Sequence:CCGGCCATACAAACTTGCATCAGTTCTCGAGAACTGATGCAAGTTTGTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032045.3-208s1c1
Sequence:CCGGGCATCCATACAACACTCTGAACTCGAGTTCAGAGTGTTGTATGGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032045
VALIDATED
KREMEN1 MISSION shRNA shRNA Plasmid DNA
kringle containing transmembrane protein 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032045.3-434s1c1
Sequence:CCGGTCCAACAAACTCACCATACAACTCGAGTTGTATGGTGAGTTTGTTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074098    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032045.3-1739s1c1
Sequence:CCGGCGTCTCTAAGAATAGAAAGAACTCGAGTTCTTTCTATTCTTAGAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032045.3-624s1c1
Sequence:CCGGGCAGGATCATCCTCTTTGATACTCGAGTATCAAAGAGGATGATCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032045.3-447s1c1
Sequence:CCGGCCATACAAACTTGCATCAGTTCTCGAGAACTGATGCAAGTTTGTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032045.3-208s1c1
Sequence:CCGGGCATCCATACAACACTCTGAACTCGAGTTCAGAGTGTTGTATGGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032045
VALIDATED
KREMEN1 MISSION shRNA Lentiviral Transduction Particles
kringle containing transmembrane protein 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032045.3-434s1c1
Sequence:CCGGTCCAACAAACTCACCATACAACTCGAGTTGTATGGTGAGTTTGTTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074098    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032045.3-1739s1c1
Sequence:CCGGCGTCTCTAAGAATAGAAAGAACTCGAGTTCTTTCTATTCTTAGAGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032045.3-624s1c1
Sequence:CCGGGCAGGATCATCCTCTTTGATACTCGAGTATCAAAGAGGATGATCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032045.3-447s1c1
Sequence:CCGGCCATACAAACTTGCATCAGTTCTCGAGAACTGATGCAAGTTTGTATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032045.3-208s1c1
Sequence:CCGGGCATCCATACAACACTCTGAACTCGAGTTCAGAGTGTTGTATGGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032396
KREMEN1 MISSION shRNA Bacterial Glycerol Stock
kringle containing transmembrane protein 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000072030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032396.2-323s1c1
Sequence:CCGGGAGCACAATTATTGCAGAAATCTCGAGATTTCTGCAATAATTGTGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032396.2-508s1c1
Sequence:CCGGGCTCACCATACAAACCTGTATCTCGAGATACAGGTTTGTATGGTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032396.2-1018s1c1
Sequence:CCGGCCAGGGATTTGCTGTGTTGTACTCGAGTACAACACAGCAAATCCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032396.2-1428s1c1
Sequence:CCGGCCACTACAATCTCCATCTTTACTCGAGTAAAGATGGAGATTGTAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072028    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032396.2-2108s1c1
Sequence:CCGGCCTGGATACTAGACTTAACTACTCGAGTAGTTAAGTCTAGTATCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000442375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032396.3-276s21c1
Sequence:CCGGATCCGTACAACACGCTGAAGTCTCGAGACTTCAGCGTGTTGTACGGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032396.3-826s21c1
Sequence:CCGGAGGAGCCTCTCGCATCCATTTCTCGAGAAATGGATGCGAGAGGCTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032396.3-1316s21c1
Sequence:CCGGATTCTTCTGCATGTCACATTTCTCGAGAAATGTGACATGCAGAAGAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032396
KREMEN1 MISSION shRNA shRNA Plasmid DNA
kringle containing transmembrane protein 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000072030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032396.2-323s1c1
Sequence:CCGGGAGCACAATTATTGCAGAAATCTCGAGATTTCTGCAATAATTGTGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032396.2-508s1c1
Sequence:CCGGGCTCACCATACAAACCTGTATCTCGAGATACAGGTTTGTATGGTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032396.2-1018s1c1
Sequence:CCGGCCAGGGATTTGCTGTGTTGTACTCGAGTACAACACAGCAAATCCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032396.2-1428s1c1
Sequence:CCGGCCACTACAATCTCCATCTTTACTCGAGTAAAGATGGAGATTGTAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072028    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032396.2-2108s1c1
Sequence:CCGGCCTGGATACTAGACTTAACTACTCGAGTAGTTAAGTCTAGTATCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000442375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032396.3-276s21c1
Sequence:CCGGATCCGTACAACACGCTGAAGTCTCGAGACTTCAGCGTGTTGTACGGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032396.3-826s21c1
Sequence:CCGGAGGAGCCTCTCGCATCCATTTCTCGAGAAATGGATGCGAGAGGCTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032396.3-1316s21c1
Sequence:CCGGATTCTTCTGCATGTCACATTTCTCGAGAAATGTGACATGCAGAAGAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032396
KREMEN1 MISSION shRNA Lentiviral Transduction Particles
kringle containing transmembrane protein 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000072030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032396.2-323s1c1
Sequence:CCGGGAGCACAATTATTGCAGAAATCTCGAGATTTCTGCAATAATTGTGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032396.2-508s1c1
Sequence:CCGGGCTCACCATACAAACCTGTATCTCGAGATACAGGTTTGTATGGTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032396.2-1018s1c1
Sequence:CCGGCCAGGGATTTGCTGTGTTGTACTCGAGTACAACACAGCAAATCCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032396.2-1428s1c1
Sequence:CCGGCCACTACAATCTCCATCTTTACTCGAGTAAAGATGGAGATTGTAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072028    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032396.2-2108s1c1
Sequence:CCGGCCTGGATACTAGACTTAACTACTCGAGTAGTTAAGTCTAGTATCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000442375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032396.3-276s21c1
Sequence:CCGGATCCGTACAACACGCTGAAGTCTCGAGACTTCAGCGTGTTGTACGGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032396.3-826s21c1
Sequence:CCGGAGGAGCCTCTCGCATCCATTTCTCGAGAAATGGATGCGAGAGGCTCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032396.3-1316s21c1
Sequence:CCGGATTCTTCTGCATGTCACATTTCTCGAGAAATGTGACATGCAGAAGAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)