EMAIL THIS PAGE TO A FRIEND

KREMEN2

kringle containing transmembrane protein 2

90 Gene Product Result for
Synonyms: KRM2
Gene ID:
Human(79412) Summary: This gene encodes a high-affinity dickkopf homolog 1 (DKK1) transmembrane receptor. A similar protein in mouse functions interacts with with DKK1 to block wingless (WNT)/beta-catenin signaling. The encoded protein forms a ternary membrane complex with DKK1 and the WNT receptor lipoprotein receptor-related protein 6 (LRP6), and induces rapid endocytosis and removal of LRP6 from the plasma membrane. It contains extracellular kringle, WSC, and CUB domains. Alternatively spliced transcript variants encoding distinct isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
Mouse(73016) kringle containing transmembrane protein 2
Rat(287102) kringle containing transmembrane protein 2
dog(610753) kringle containing transmembrane protein 2
cow(618527) kringle containing transmembrane protein 2
domestic cat(101098677) kringle containing transmembrane protein 2
domestic guinea pig(100734476) kringle containing transmembrane protein 2
naked mole-rat(101720049) kringle containing transmembrane protein 2
sheep(101119273) kringle containing transmembrane protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028416 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028416 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028416 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024507 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024507 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024507 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU007571 MISSION® esiRNA esiRNA targeting mouse Kremen2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024507 Rosetta Predictions human pricing
NM_172229 Rosetta Predictions human pricing
NM_001105767 Rosetta Predictions rat pricing
NM_028416 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024507 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00088504 predicted 1714
2 SASI_Hs01_00088505 predicted 865
3 SASI_Hs01_00088506 predicted 861
4 SASI_Hs01_00088507 predicted 1647
5 SASI_Hs02_00356776 predicted 909
6 SASI_Hs01_00088508 predicted 915
7 SASI_Hs01_00088509 predicted 869
8 SASI_Hs01_00088510 predicted 1650
9 SASI_Hs01_00088511 predicted 1000
10 SASI_Hs01_00088513 predicted 974
11 SASI_Hs01_00088512 predicted 1632
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172229 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00029379 predicted 857
2 SASI_Hs01_00029380 predicted 859
3 SASI_Hs01_00029381 predicted 1721
4 SASI_Hs02_00367938 predicted 916
5 SASI_Hs01_00029382 predicted 920
6 SASI_Hs01_00029383 predicted 862
7 SASI_Hs01_00029384 predicted 1725
8 SASI_Hs01_00029385 predicted 998
9 SASI_Hs01_00029386 predicted 1714
10 SASI_Hs01_00029387 predicted 967
11 SASI_Hs01_00029378 predicted 1795
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105767 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00212326 predicted 216
2 SASI_Rn02_00212327 predicted 1582
3 SASI_Rn02_00212328 predicted 256
4 SASI_Rn02_00212329 predicted 457
5 SASI_Rn02_00212330 predicted 382
6 SASI_Rn02_00212331 predicted 583
7 SASI_Rn02_00212332 predicted 697
8 SASI_Rn02_00212333 predicted 748
9 SASI_Rn02_00212334 predicted 1596
10 SASI_Rn02_00212335 predicted 914
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028416 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00333807 predicted 422
2 SASI_Mm02_00333808 predicted 494
3 SASI_Mm02_00333809 predicted 849
4 SASI_Mm02_00333810 predicted 626
5 SASI_Mm02_00333811 predicted 743
6 SASI_Mm02_00333812 predicted 1619
7 SASI_Mm02_00333813 predicted 896
8 SASI_Mm02_00333814 predicted 964
9 SASI_Mm02_00333815 predicted 621
10 SASI_Mm02_00333816 predicted 1780
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028416
KREMEN2 MISSION shRNA Bacterial Glycerol Stock
kringle containing transmembrane protein 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028416.1-634s1c1
Sequence:CCGGCCTTCGATTCTGCCGCATGAACTCGAGTTCATGCGGCAGAATCGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028416.1-430s1c1
Sequence:CCGGTGCGCATAACTTCTGTAGGAACTCGAGTTCCTACAGAAGTTATGCGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028416.1-959s1c1
Sequence:CCGGCGCCTCTTCGAGTTGGCTGATCTCGAGATCAGCCAACTCGAAGAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028416.1-1173s1c1
Sequence:CCGGGCAGAGCATCTCCAGAGGATTCTCGAGAATCCTCTGGAGATGCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028416.1-794s1c1
Sequence:CCGGGATGGACGACTAGGCATCTATCTCGAGATAGATGCCTAGTCGTCCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028416
KREMEN2 MISSION shRNA shRNA Plasmid DNA
kringle containing transmembrane protein 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028416.1-634s1c1
Sequence:CCGGCCTTCGATTCTGCCGCATGAACTCGAGTTCATGCGGCAGAATCGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028416.1-430s1c1
Sequence:CCGGTGCGCATAACTTCTGTAGGAACTCGAGTTCCTACAGAAGTTATGCGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028416.1-959s1c1
Sequence:CCGGCGCCTCTTCGAGTTGGCTGATCTCGAGATCAGCCAACTCGAAGAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028416.1-1173s1c1
Sequence:CCGGGCAGAGCATCTCCAGAGGATTCTCGAGAATCCTCTGGAGATGCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028416.1-794s1c1
Sequence:CCGGGATGGACGACTAGGCATCTATCTCGAGATAGATGCCTAGTCGTCCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028416
KREMEN2 MISSION shRNA Lentiviral Transduction Particles
kringle containing transmembrane protein 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028416.1-634s1c1
Sequence:CCGGCCTTCGATTCTGCCGCATGAACTCGAGTTCATGCGGCAGAATCGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028416.1-430s1c1
Sequence:CCGGTGCGCATAACTTCTGTAGGAACTCGAGTTCCTACAGAAGTTATGCGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028416.1-959s1c1
Sequence:CCGGCGCCTCTTCGAGTTGGCTGATCTCGAGATCAGCCAACTCGAAGAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028416.1-1173s1c1
Sequence:CCGGGCAGAGCATCTCCAGAGGATTCTCGAGAATCCTCTGGAGATGCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028416.1-794s1c1
Sequence:CCGGGATGGACGACTAGGCATCTATCTCGAGATAGATGCCTAGTCGTCCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024507
KREMEN2 MISSION shRNA Bacterial Glycerol Stock
kringle containing transmembrane protein 2
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024507.2-761s1c1
Sequence:CCGGCCTACGCTTCTGCCGCATGAACTCGAGTTCATGCGGCAGAAGCGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438544    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024507.2-1599s21c1
Sequence:CCGGTCATCTCCGCTCTCTGACTCTCTCGAGAGAGTCAGAGAGCGGAGATGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024507.2-866s1c1
Sequence:CCGGCGCCACCGACTGTGACCAGATCTCGAGATCTGGTCACAGTCGGTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024507.2-405s1c1
Sequence:CCGGTCCGAATGCTTCCAGGTGAATCTCGAGATTCACCTGGAAGCATTCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118247    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024507.2-1751s1c1
Sequence:CCGGGACAGGAAACATCTGGTGCTACTCGAGTAGCACCAGATGTTTCCTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024507.2-1001s1c1
Sequence:CCGGCCCGGACTTCCCGGACGAGTACTCGAGTACTCGTCCGGGAAGTCCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024507
KREMEN2 MISSION shRNA shRNA Plasmid DNA
kringle containing transmembrane protein 2
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024507.2-761s1c1
Sequence:CCGGCCTACGCTTCTGCCGCATGAACTCGAGTTCATGCGGCAGAAGCGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438544    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024507.2-1599s21c1
Sequence:CCGGTCATCTCCGCTCTCTGACTCTCTCGAGAGAGTCAGAGAGCGGAGATGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024507.2-866s1c1
Sequence:CCGGCGCCACCGACTGTGACCAGATCTCGAGATCTGGTCACAGTCGGTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024507.2-405s1c1
Sequence:CCGGTCCGAATGCTTCCAGGTGAATCTCGAGATTCACCTGGAAGCATTCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118247    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024507.2-1751s1c1
Sequence:CCGGGACAGGAAACATCTGGTGCTACTCGAGTAGCACCAGATGTTTCCTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024507.2-1001s1c1
Sequence:CCGGCCCGGACTTCCCGGACGAGTACTCGAGTACTCGTCCGGGAAGTCCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024507
KREMEN2 MISSION shRNA Lentiviral Transduction Particles
kringle containing transmembrane protein 2
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024507.2-761s1c1
Sequence:CCGGCCTACGCTTCTGCCGCATGAACTCGAGTTCATGCGGCAGAAGCGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438544    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024507.2-1599s21c1
Sequence:CCGGTCATCTCCGCTCTCTGACTCTCTCGAGAGAGTCAGAGAGCGGAGATGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024507.2-866s1c1
Sequence:CCGGCGCCACCGACTGTGACCAGATCTCGAGATCTGGTCACAGTCGGTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024507.2-405s1c1
Sequence:CCGGTCCGAATGCTTCCAGGTGAATCTCGAGATTCACCTGGAAGCATTCGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118247    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024507.2-1751s1c1
Sequence:CCGGGACAGGAAACATCTGGTGCTACTCGAGTAGCACCAGATGTTTCCTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024507.2-1001s1c1
Sequence:CCGGCCCGGACTTCCCGGACGAGTACTCGAGTACTCGTCCGGGAAGTCCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)