EMAIL THIS PAGE TO A FRIEND

KRI1

KRI1 homolog (S. cerevisiae)

55 Gene Product Result for
Gene ID:
Human(65095) Summary: This gene overlaps with the gene for cysteine endopeptidase AUT-like 4 in a head-to-tail orientation. [provided by RefSeq, Jul 2008]
Mouse(215194) KRI1 homolog (S. cerevisiae)
Zebrafish(402800) KRI1 homolog
cow(511427) KRI1 homolog (S. cerevisiae)
Horse(100057800) KRI1 homolog (S. cerevisiae)
domestic cat(101094988) KRI1 homolog (S. cerevisiae)
dog(484952) KRI1 homolog (S. cerevisiae)
sheep(101114104) KRI1 homolog (S. cerevisiae)
domestic guinea pig(100722852) KRI1 homolog (S. cerevisiae)
naked mole-rat(101719574) KRI1 homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178159 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178159 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178159 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145416 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145416 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145416 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_023008 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_023008 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_023008 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_023008 Rosetta Predictions human pricing
NM_178159 Rosetta Predictions human pricing
NM_145416 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023008 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00221543 predicted 517
2 SASI_Hs01_00221544 predicted 409
3 SASI_Hs01_00221545 predicted 1812
4 SASI_Hs01_00221546 predicted 1637
5 SASI_Hs02_00356270 predicted 374
6 SASI_Hs01_00221547 predicted 1524
7 SASI_Hs01_00221548 predicted 1740
8 SASI_Hs01_00221549 predicted 2019
9 SASI_Hs02_00356271 predicted 353
10 SASI_Hs01_00221550 predicted 1873
11 SASI_Hs01_00221542 predicted 465
12 SASI_Hs01_00221551 predicted 1662
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178159 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00018444 predicted 393
2 SASI_Hs01_00018445 predicted 449
3 SASI_Hs01_00018446 predicted 338
4 SASI_Hs01_00018447 predicted 1737
5 SASI_Hs01_00018448 predicted 1566
6 SASI_Hs01_00018449 predicted 1452
7 SASI_Hs01_00018450 predicted 1670
8 SASI_Hs01_00018451 predicted 1953
9 SASI_Hs01_00018452 predicted 1808
10 SASI_Hs01_00018453 predicted 1588
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145416 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00081691 predicted 469
2 SASI_Mm01_00081693 predicted 2083
3 SASI_Mm01_00081695 predicted 476
4 SASI_Mm02_00340760 predicted 465
5 SASI_Mm02_00340761 predicted 1646
6 SASI_Mm01_00081698 predicted 464
7 SASI_Mm02_00340762 predicted 1069
8 SASI_Mm01_00081699 predicted 1942
9 SASI_Mm02_00340763 predicted 2039
10 SASI_Mm01_00081700 predicted 375
11 SASI_Mm01_00081692 predicted 473
12 SASI_Mm01_00081694 predicted 1513
13 SASI_Mm01_00081696 predicted 415
14 SASI_Mm01_00081697 predicted 2020
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178159
VALIDATED
KRI1 MISSION shRNA Bacterial Glycerol Stock
KRI1 homolog (S. cerevisiae)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130782    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178159.1-2503s1c1
Sequence:CCGGGCTGACTTAAACTTCCCGTGACTCGAGTCACGGGAAGTTTAAGTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130533    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178159.1-619s1c1
Sequence:CCGGGCATCTCAAGGAATACTGGAACTCGAGTTCCAGTATTCCTTGAGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_178159.1-1060s1c1
Sequence:CCGGGAAAGTAACAGGCAACGAGATCTCGAGATCTCGTTGCCTGTTACTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_178159.1-1193s1c1
Sequence:CCGGCCACAATTTGAGGAAGAAGAACTCGAGTTCTTCTTCCTCAAATTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128855    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178159.1-977s1c1
Sequence:CCGGGAGAAAGCAAAGAAGCAGGAACTCGAGTTCCTGCTTCTTTGCTTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_178159.1-1187s1c1
Sequence:CCGGGAGAAGCCACAATTTGAGGAACTCGAGTTCCTCAAATTGTGGCTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129729    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178159.1-2595s1c1
Sequence:CCGGCGATCAAGTTACACAGCTTTACTCGAGTAAAGCTGTGTAACTTGATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130341    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_178159.1-2506s1c1
Sequence:CCGGGACTTAAACTTCCCGTGACTTCTCGAGAAGTCACGGGAAGTTTAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178159
VALIDATED
KRI1 MISSION shRNA shRNA Plasmid DNA
KRI1 homolog (S. cerevisiae)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130782    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178159.1-2503s1c1
Sequence:CCGGGCTGACTTAAACTTCCCGTGACTCGAGTCACGGGAAGTTTAAGTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130533    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178159.1-619s1c1
Sequence:CCGGGCATCTCAAGGAATACTGGAACTCGAGTTCCAGTATTCCTTGAGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_178159.1-1060s1c1
Sequence:CCGGGAAAGTAACAGGCAACGAGATCTCGAGATCTCGTTGCCTGTTACTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_178159.1-1193s1c1
Sequence:CCGGCCACAATTTGAGGAAGAAGAACTCGAGTTCTTCTTCCTCAAATTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128855    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178159.1-977s1c1
Sequence:CCGGGAGAAAGCAAAGAAGCAGGAACTCGAGTTCCTGCTTCTTTGCTTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_178159.1-1187s1c1
Sequence:CCGGGAGAAGCCACAATTTGAGGAACTCGAGTTCCTCAAATTGTGGCTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129729    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178159.1-2595s1c1
Sequence:CCGGCGATCAAGTTACACAGCTTTACTCGAGTAAAGCTGTGTAACTTGATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130341    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_178159.1-2506s1c1
Sequence:CCGGGACTTAAACTTCCCGTGACTTCTCGAGAAGTCACGGGAAGTTTAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178159
VALIDATED
KRI1 MISSION shRNA Lentiviral Transduction Particles
KRI1 homolog (S. cerevisiae)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130782    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178159.1-2503s1c1
Sequence:CCGGGCTGACTTAAACTTCCCGTGACTCGAGTCACGGGAAGTTTAAGTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130533    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178159.1-619s1c1
Sequence:CCGGGCATCTCAAGGAATACTGGAACTCGAGTTCCAGTATTCCTTGAGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_178159.1-1060s1c1
Sequence:CCGGGAAAGTAACAGGCAACGAGATCTCGAGATCTCGTTGCCTGTTACTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_178159.1-1193s1c1
Sequence:CCGGCCACAATTTGAGGAAGAAGAACTCGAGTTCTTCTTCCTCAAATTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128855    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178159.1-977s1c1
Sequence:CCGGGAGAAAGCAAAGAAGCAGGAACTCGAGTTCCTGCTTCTTTGCTTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_178159.1-1187s1c1
Sequence:CCGGGAGAAGCCACAATTTGAGGAACTCGAGTTCCTCAAATTGTGGCTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129729    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178159.1-2595s1c1
Sequence:CCGGCGATCAAGTTACACAGCTTTACTCGAGTAAAGCTGTGTAACTTGATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130341    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_178159.1-2506s1c1
Sequence:CCGGGACTTAAACTTCCCGTGACTTCTCGAGAAGTCACGGGAAGTTTAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145416
VALIDATED
KRI1 MISSION shRNA Bacterial Glycerol Stock
KRI1 homolog (S. cerevisiae)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000241666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145416.3-238s21c1
Sequence:CCGGGAAGAAGGACCCTCGAATTTACTCGAGTAAATTCGAGGGTCCTTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145416.3-745s21c1
Sequence:CCGGACAGTTCCTGAGGGATTATATCTCGAGATATAATCCCTCAGGAACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145416.3-170s21c1
Sequence:CCGGAGCGATGAGCATGTGGAATTTCTCGAGAAATTCCACATGCTCATCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145416.3-634s21c1
Sequence:CCGGGGACTACCTTGAGTGGCTAAACTCGAGTTTAGCCACTCAAGGTAGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145416.3-1551s21c1
Sequence:CCGGGTCTGGACTACGAGGACATTACTCGAGTAATGTCCTCGTAGTCCAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145416
VALIDATED
KRI1 MISSION shRNA shRNA Plasmid DNA
KRI1 homolog (S. cerevisiae)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000241666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145416.3-238s21c1
Sequence:CCGGGAAGAAGGACCCTCGAATTTACTCGAGTAAATTCGAGGGTCCTTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145416.3-745s21c1
Sequence:CCGGACAGTTCCTGAGGGATTATATCTCGAGATATAATCCCTCAGGAACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145416.3-170s21c1
Sequence:CCGGAGCGATGAGCATGTGGAATTTCTCGAGAAATTCCACATGCTCATCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145416.3-634s21c1
Sequence:CCGGGGACTACCTTGAGTGGCTAAACTCGAGTTTAGCCACTCAAGGTAGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145416.3-1551s21c1
Sequence:CCGGGTCTGGACTACGAGGACATTACTCGAGTAATGTCCTCGTAGTCCAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145416
VALIDATED
KRI1 MISSION shRNA Lentiviral Transduction Particles
KRI1 homolog (S. cerevisiae)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000241666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145416.3-238s21c1
Sequence:CCGGGAAGAAGGACCCTCGAATTTACTCGAGTAAATTCGAGGGTCCTTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145416.3-745s21c1
Sequence:CCGGACAGTTCCTGAGGGATTATATCTCGAGATATAATCCCTCAGGAACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145416.3-170s21c1
Sequence:CCGGAGCGATGAGCATGTGGAATTTCTCGAGAAATTCCACATGCTCATCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145416.3-634s21c1
Sequence:CCGGGGACTACCTTGAGTGGCTAAACTCGAGTTTAGCCACTCAAGGTAGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145416.3-1551s21c1
Sequence:CCGGGTCTGGACTACGAGGACATTACTCGAGTAATGTCCTCGTAGTCCAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023008
KRI1 MISSION shRNA Bacterial Glycerol Stock
KRI1 homolog (S. cerevisiae)
Human
1 Products Total
TRC Number Price Set Price (1)? Select
TRCN0000219999    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023008.3-1644s1c1
Sequence:CCGGGATCCTCGCTGCTGACGATAACTCGAGTTATCGTCAGCAGCGAGGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023008
KRI1 MISSION shRNA shRNA Plasmid DNA
KRI1 homolog (S. cerevisiae)
Human
1 Products Total
TRC Number Vector Price Set Price (1)? Select
TRCN0000219999    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023008.3-1644s1c1
Sequence:CCGGGATCCTCGCTGCTGACGATAACTCGAGTTATCGTCAGCAGCGAGGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023008
KRI1 MISSION shRNA Lentiviral Transduction Particles
KRI1 homolog (S. cerevisiae)
Human
1 Products Total
TRC Number Volume Titer Vector Price Set Price (1)? Select
TRCN0000219999    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023008.3-1644s1c1
Sequence:CCGGGATCCTCGCTGCTGACGATAACTCGAGTTATCGTCAGCAGCGAGGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)