EMAIL THIS PAGE TO A FRIEND

KRIT1

KRIT1, ankyrin repeat containing

128 Gene Product Result for
Synonyms: CAM CCM1
Gene ID:
Human(889) Summary: This gene encodes a protein containing four ankyrin repeats, a band 4.1/ezrin/radixin/moesin (FERM) domain, and multiple NPXY sequences. The encoded protein is localized in the nucleus and cytoplasm. It binds to integrin cytoplasmic domain-associated protein-1 alpha (ICAP1alpha), and plays a critical role in beta1-integrin-mediated cell proliferation. It associates with junction proteins and RAS-related protein 1A (Rap1A), which requires the encoded protein for maintaining the integrity of endothelial junctions. It is also a microtubule-associated protein and may play a role in microtubule targeting. Mutations in this gene result in cerebral cavernous malformations. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2009]
Mouse(79264) KRIT1, ankyrin repeat containing
Rat(362317) KRIT1, ankyrin repeat containing
Zebrafish(321836) KRIT1, ankyrin repeat containing
cow(407996) KRIT1, ankyrin repeat containing
Horse(100050998) KRIT1, ankyrin repeat containing
domestic cat(101083757) KRIT1, ankyrin repeat containing
dog(482299) KRIT1, ankyrin repeat containing
chicken(420549) KRIT1, ankyrin repeat containing
domestic guinea pig(100731041) KRIT1, ankyrin repeat containing
naked mole-rat(101725749) KRIT1, ankyrin repeat containing
sheep(101110497) KRIT1, ankyrin repeat containing
Domestic Rabbit(100344408) KRIT1, ankyrin repeat containing
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030675 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030675 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030675 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004912 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004912 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004912 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013406 Rosetta Predictions human pricing
NM_004912 Rosetta Predictions human pricing
NM_194454 Rosetta Predictions human pricing
NM_194455 Rosetta Predictions human pricing
NM_194456 Rosetta Predictions human pricing
NM_001108618 Rosetta Predictions rat pricing
NM_030675 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013406 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00188870 predicted 2270
2 SASI_Hs01_00188871 predicted 1630
3 SASI_Hs01_00188872 predicted 2045
4 SASI_Hs01_00188874 predicted 1661
5 SASI_Hs02_00306358 predicted 2120
6 SASI_Hs01_00188875 predicted 1013
7 SASI_Hs01_00188876 predicted 2287
8 SASI_Hs01_00188878 predicted 2050
9 SASI_Hs01_00188879 predicted 842
10 SASI_Hs02_00306359 predicted 1806
11 SASI_Hs01_00188873 predicted 1934
12 SASI_Hs01_00188877 predicted 2149
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004912 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00033309 predicted 2914
2 SASI_Hs01_00033310 predicted 2271
3 SASI_Hs01_00033311 predicted 2678
4 SASI_Hs01_00033313 predicted 2303
5 SASI_Hs02_00338573 predicted 2762
6 SASI_Hs01_00033314 predicted 1508
7 SASI_Hs01_00033315 predicted 2925
8 SASI_Hs01_00033317 predicted 2690
9 SASI_Hs01_00033318 predicted 1337
10 SASI_Hs02_00338574 predicted 2450
11 SASI_Hs01_00033312 predicted 2576
12 SASI_Hs01_00033316 predicted 2787
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194454 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00058471 predicted 2569
2 SASI_Hs01_00058472 predicted 1920
3 SASI_Hs01_00058473 predicted 2330
4 SASI_Hs01_00058475 predicted 1955
5 SASI_Hs02_00371534 predicted 2419
6 SASI_Hs01_00058476 predicted 1161
7 SASI_Hs01_00058477 predicted 2575
8 SASI_Hs01_00058479 predicted 2338
9 SASI_Hs01_00058480 predicted 995
10 SASI_Hs02_00371535 predicted 2101
11 SASI_Hs01_00058474 predicted 2229
12 SASI_Hs01_00058478 predicted 2442
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194455 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00181572 predicted 3042
2 SASI_Hs01_00181573 predicted 2396
3 SASI_Hs01_00181574 predicted 2810
4 SASI_Hs01_00181576 predicted 2434
5 SASI_Hs02_00371536 predicted 2884
6 SASI_Hs01_00181577 predicted 1638
7 SASI_Hs01_00181578 predicted 3051
8 SASI_Hs01_00181580 predicted 2816
9 SASI_Hs01_00181581 predicted 1471
10 SASI_Hs02_00371537 predicted 2576
11 SASI_Hs01_00181575 predicted 2703
12 SASI_Hs01_00181579 predicted 2920
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194456 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00162426 predicted 2805
2 SASI_Hs01_00162427 predicted 2166
3 SASI_Hs01_00162428 predicted 2571
4 SASI_Hs01_00162430 predicted 2191
5 SASI_Hs02_00371538 predicted 2655
6 SASI_Hs01_00162431 predicted 1408
7 SASI_Hs01_00162432 predicted 2819
8 SASI_Hs01_00162434 predicted 2575
9 SASI_Hs01_00162435 predicted 1237
10 SASI_Hs02_00371539 predicted 2343
11 SASI_Hs01_00162429 predicted 2471
12 SASI_Hs01_00162433 predicted 2683
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108618 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00240409 predicted 973
2 SASI_Rn02_00240410 predicted 361
3 SASI_Rn02_00240411 predicted 1584
4 SASI_Rn02_00240412 predicted 516
5 SASI_Rn02_00240413 predicted 2087
6 SASI_Rn02_00240414 predicted 795
7 SASI_Rn02_00240415 predicted 423
8 SASI_Rn02_00240416 predicted 1280
9 SASI_Rn02_00240417 predicted 1660
10 SASI_Rn02_00240418 predicted 1819
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030675 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00336818 predicted 2487
2 SASI_Mm01_00065224 predicted 1424
3 SASI_Mm02_00336819 predicted 699
4 SASI_Mm01_00065225 predicted 1537
5 SASI_Mm01_00065226 predicted 2337
6 SASI_Mm01_00065227 predicted 2036
7 SASI_Mm01_00065228 predicted 1229
8 SASI_Mm01_00065229 predicted 1955
9 SASI_Mm01_00065230 predicted 725
10 SASI_Mm01_00065231 predicted 2319
11 SASI_Mm01_00065232 predicted 697
12 SASI_Mm01_00065233 predicted 2100
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030675
KRIT1 MISSION shRNA Bacterial Glycerol Stock
KRIT1, ankyrin repeat containing
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000325211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030675.2-2049s21c1
Sequence:CCGGCGTACCTATTACTAAACTGAACTCGAGTTCAGTTTAGTAATAGGTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030675.2-2445s21c1
Sequence:CCGGCCTTGTGGTAAAGCTGCTAATCTCGAGATTAGCAGCTTTACCACAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030675.2-2266s21c1
Sequence:CCGGCCTGTGTATGTAGGAGTGAATCTCGAGATTCACTCCTACATACACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030675.2-2079s21c1
Sequence:CCGGGCCTCACTGGATAAACCGAATCTCGAGATTCGGTTTATCCAGTGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325213    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030675.2-2695s21c1
Sequence:CCGGGCTCATAAGCTCTTCTAATTTCTCGAGAAATTAGAAGAGCTTATGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105935    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030675.2-2695s1c1
Sequence:CCGGGCTCATAAGCTCTTCTAATTTCTCGAGAAATTAGAAGAGCTTATGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030675.2-2049s1c1
Sequence:CCGGCGTACCTATTACTAAACTGAACTCGAGTTCAGTTTAGTAATAGGTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030675.2-2445s1c1
Sequence:CCGGCCTTGTGGTAAAGCTGCTAATCTCGAGATTAGCAGCTTTACCACAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030675.2-2079s1c1
Sequence:CCGGGCCTCACTGGATAAACCGAATCTCGAGATTCGGTTTATCCAGTGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030675.2-2266s1c1
Sequence:CCGGCCTGTGTATGTAGGAGTGAATCTCGAGATTCACTCCTACATACACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030675
KRIT1 MISSION shRNA shRNA Plasmid DNA
KRIT1, ankyrin repeat containing
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000325211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030675.2-2049s21c1
Sequence:CCGGCGTACCTATTACTAAACTGAACTCGAGTTCAGTTTAGTAATAGGTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030675.2-2445s21c1
Sequence:CCGGCCTTGTGGTAAAGCTGCTAATCTCGAGATTAGCAGCTTTACCACAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030675.2-2266s21c1
Sequence:CCGGCCTGTGTATGTAGGAGTGAATCTCGAGATTCACTCCTACATACACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030675.2-2079s21c1
Sequence:CCGGGCCTCACTGGATAAACCGAATCTCGAGATTCGGTTTATCCAGTGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325213    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030675.2-2695s21c1
Sequence:CCGGGCTCATAAGCTCTTCTAATTTCTCGAGAAATTAGAAGAGCTTATGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105935    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030675.2-2695s1c1
Sequence:CCGGGCTCATAAGCTCTTCTAATTTCTCGAGAAATTAGAAGAGCTTATGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030675.2-2049s1c1
Sequence:CCGGCGTACCTATTACTAAACTGAACTCGAGTTCAGTTTAGTAATAGGTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030675.2-2445s1c1
Sequence:CCGGCCTTGTGGTAAAGCTGCTAATCTCGAGATTAGCAGCTTTACCACAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030675.2-2079s1c1
Sequence:CCGGGCCTCACTGGATAAACCGAATCTCGAGATTCGGTTTATCCAGTGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030675.2-2266s1c1
Sequence:CCGGCCTGTGTATGTAGGAGTGAATCTCGAGATTCACTCCTACATACACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030675
KRIT1 MISSION shRNA Lentiviral Transduction Particles
KRIT1, ankyrin repeat containing
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000325211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030675.2-2049s21c1
Sequence:CCGGCGTACCTATTACTAAACTGAACTCGAGTTCAGTTTAGTAATAGGTACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030675.2-2445s21c1
Sequence:CCGGCCTTGTGGTAAAGCTGCTAATCTCGAGATTAGCAGCTTTACCACAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030675.2-2266s21c1
Sequence:CCGGCCTGTGTATGTAGGAGTGAATCTCGAGATTCACTCCTACATACACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030675.2-2079s21c1
Sequence:CCGGGCCTCACTGGATAAACCGAATCTCGAGATTCGGTTTATCCAGTGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325213    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030675.2-2695s21c1
Sequence:CCGGGCTCATAAGCTCTTCTAATTTCTCGAGAAATTAGAAGAGCTTATGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105935    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030675.2-2695s1c1
Sequence:CCGGGCTCATAAGCTCTTCTAATTTCTCGAGAAATTAGAAGAGCTTATGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030675.2-2049s1c1
Sequence:CCGGCGTACCTATTACTAAACTGAACTCGAGTTCAGTTTAGTAATAGGTACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030675.2-2445s1c1
Sequence:CCGGCCTTGTGGTAAAGCTGCTAATCTCGAGATTAGCAGCTTTACCACAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030675.2-2079s1c1
Sequence:CCGGGCCTCACTGGATAAACCGAATCTCGAGATTCGGTTTATCCAGTGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030675.2-2266s1c1
Sequence:CCGGCCTGTGTATGTAGGAGTGAATCTCGAGATTCACTCCTACATACACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004912
KRIT1 MISSION shRNA Bacterial Glycerol Stock
KRIT1, ankyrin repeat containing
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000291592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004912.3-1367s21c1
Sequence:CCGGGCCTTGGATAAGTGGTTAGATCTCGAGATCTAACCACTTATCCAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291594    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004912.3-4004s21c1
Sequence:CCGGCCCATTCTAAACAAGGGCATTCTCGAGAATGCCCTTGTTTAGAATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004912.3-1619s21c1
Sequence:CCGGCGGGTAGATAAAGTGGTAATACTCGAGTATTACCACTTTATCTACCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004912.3-954s21c1
Sequence:CCGGCCAGTCTCAATTCTCGGGAATCTCGAGATTCCCGAGAATTGAGACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004912.3-1806s21c1
Sequence:CCGGGCCGTCTTCTCAGTGAAAGATCTCGAGATCTTTCACTGAGAAGACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072878    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004912.3-4004s1c1
Sequence:CCGGCCCATTCTAAACAAGGGCATTCTCGAGAATGCCCTTGTTTAGAATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004912.3-954s1c1
Sequence:CCGGCCAGTCTCAATTCTCGGGAATCTCGAGATTCCCGAGAATTGAGACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004912.3-1367s1c1
Sequence:CCGGGCCTTGGATAAGTGGTTAGATCTCGAGATCTAACCACTTATCCAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004912.3-1806s1c1
Sequence:CCGGGCCGTCTTCTCAGTGAAAGATCTCGAGATCTTTCACTGAGAAGACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004912.3-1619s1c1
Sequence:CCGGCGGGTAGATAAAGTGGTAATACTCGAGTATTACCACTTTATCTACCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004912
KRIT1 MISSION shRNA shRNA Plasmid DNA
KRIT1, ankyrin repeat containing
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000291592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004912.3-1367s21c1
Sequence:CCGGGCCTTGGATAAGTGGTTAGATCTCGAGATCTAACCACTTATCCAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291594    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004912.3-4004s21c1
Sequence:CCGGCCCATTCTAAACAAGGGCATTCTCGAGAATGCCCTTGTTTAGAATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004912.3-1619s21c1
Sequence:CCGGCGGGTAGATAAAGTGGTAATACTCGAGTATTACCACTTTATCTACCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004912.3-954s21c1
Sequence:CCGGCCAGTCTCAATTCTCGGGAATCTCGAGATTCCCGAGAATTGAGACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004912.3-1806s21c1
Sequence:CCGGGCCGTCTTCTCAGTGAAAGATCTCGAGATCTTTCACTGAGAAGACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072878    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004912.3-4004s1c1
Sequence:CCGGCCCATTCTAAACAAGGGCATTCTCGAGAATGCCCTTGTTTAGAATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004912.3-954s1c1
Sequence:CCGGCCAGTCTCAATTCTCGGGAATCTCGAGATTCCCGAGAATTGAGACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004912.3-1367s1c1
Sequence:CCGGGCCTTGGATAAGTGGTTAGATCTCGAGATCTAACCACTTATCCAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004912.3-1806s1c1
Sequence:CCGGGCCGTCTTCTCAGTGAAAGATCTCGAGATCTTTCACTGAGAAGACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004912.3-1619s1c1
Sequence:CCGGCGGGTAGATAAAGTGGTAATACTCGAGTATTACCACTTTATCTACCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004912
KRIT1 MISSION shRNA Lentiviral Transduction Particles
KRIT1, ankyrin repeat containing
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000291592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004912.3-1367s21c1
Sequence:CCGGGCCTTGGATAAGTGGTTAGATCTCGAGATCTAACCACTTATCCAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291594    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004912.3-4004s21c1
Sequence:CCGGCCCATTCTAAACAAGGGCATTCTCGAGAATGCCCTTGTTTAGAATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004912.3-1619s21c1
Sequence:CCGGCGGGTAGATAAAGTGGTAATACTCGAGTATTACCACTTTATCTACCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004912.3-954s21c1
Sequence:CCGGCCAGTCTCAATTCTCGGGAATCTCGAGATTCCCGAGAATTGAGACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004912.3-1806s21c1
Sequence:CCGGGCCGTCTTCTCAGTGAAAGATCTCGAGATCTTTCACTGAGAAGACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072878    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004912.3-4004s1c1
Sequence:CCGGCCCATTCTAAACAAGGGCATTCTCGAGAATGCCCTTGTTTAGAATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004912.3-954s1c1
Sequence:CCGGCCAGTCTCAATTCTCGGGAATCTCGAGATTCCCGAGAATTGAGACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004912.3-1367s1c1
Sequence:CCGGGCCTTGGATAAGTGGTTAGATCTCGAGATCTAACCACTTATCCAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004912.3-1806s1c1
Sequence:CCGGGCCGTCTTCTCAGTGAAAGATCTCGAGATCTTTCACTGAGAAGACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004912.3-1619s1c1
Sequence:CCGGCGGGTAGATAAAGTGGTAATACTCGAGTATTACCACTTTATCTACCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)