EMAIL THIS PAGE TO A FRIEND

KRR1

KRR1, small subunit (SSU) processome component, homolog (yeast)

80 Gene Product Result for
Synonyms: HRB2 RIP-1
Gene ID:
Mouse(52705) KRR1, small subunit (SSU) processome component, homolog (yeast)
Rat(314830) KRR1, small subunit (SSU) processome component, homolog (yeast)
Zebrafish(724049) KRR1, small subunit (SSU) processome component, homolog (yeast)
chicken(417863) KRR1, small subunit (SSU) processome component, homolog (yeast)
dog(475405) KRR1, small subunit (SSU) processome component, homolog (yeast)
domestic cat(101082925) KRR1, small subunit (SSU) processome component, homolog (yeast)
cow(513714) KRR1, small subunit (SSU) processome component, homolog (yeast)
Horse(100050169) KRR1, small subunit (SSU) processome component, homolog (yeast)
sheep(101122012) KRR1, small subunit (SSU) processome component, homolog (yeast)
domestic guinea pig(100724962) KRR1, small subunit (SSU) processome component, homolog (yeast)
naked mole-rat(101710055) KRR1, small subunit (SSU) processome component, homolog (yeast)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178610 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178610 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178610 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_007043 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007043 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007043 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007043 Rosetta Predictions human pricing
NM_001108094 Rosetta Predictions rat pricing
XM_235128 Rosetta Predictions rat pricing
NM_178610 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007043 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00063028 predicted 281
2 SASI_Hs01_00063029 predicted 262
3 SASI_Hs01_00063030 predicted 449
4 SASI_Hs01_00063031 predicted 575
5 SASI_Hs01_00063032 predicted 732
6 SASI_Hs01_00063033 predicted 401
7 SASI_Hs01_00063034 predicted 402
8 SASI_Hs01_00063035 predicted 325
9 SASI_Hs01_00063037 predicted 276
10 SASI_Hs02_00342830 predicted 551
11 SASI_Hs01_00063036 predicted 538
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108094 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00235294 predicted 833
2 SASI_Rn02_00235295 predicted 847
3 SASI_Rn02_00235296 predicted 1065
4 SASI_Rn02_00235297 predicted 1141
5 SASI_Rn02_00235298 predicted 1195
6 SASI_Rn02_00235299 predicted 909
7 SASI_Rn02_00235300 predicted 424
8 SASI_Rn02_00235301 predicted 490
9 SASI_Rn02_00235302 predicted 476
10 SASI_Rn02_00235303 predicted 800
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_235128 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00159610 predicted 697
2 SASI_Rn01_00159611 predicted 245
3 SASI_Rn01_00159612 predicted 708
4 SASI_Rn01_00159613 predicted 928
5 SASI_Rn01_00159614 predicted 764
6 SASI_Rn01_00159615 predicted 288
7 SASI_Rn01_00159616 predicted 349
8 SASI_Rn01_00159617 predicted 632
9 SASI_Rn01_00159618 predicted 340
10 SASI_Rn01_00159619 predicted 670
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178610 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00030647 predicted 998
2 SASI_Mm01_00030648 predicted 246
3 SASI_Mm01_00030649 predicted 1060
4 SASI_Mm01_00030650 predicted 1005
5 SASI_Mm01_00030651 predicted 674
6 SASI_Mm01_00030652 predicted 298
7 SASI_Mm01_00030653 predicted 924
8 SASI_Mm02_00348960 predicted 769
9 SASI_Mm01_00030654 predicted 344
10 SASI_Mm01_00030655 predicted 1068
11 SASI_Mm01_00030656 predicted 1052
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178610
VALIDATED
KRR1 MISSION shRNA Bacterial Glycerol Stock
KRR1, small subunit (SSU) processome component, homolog (yeast)
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102255    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178610.2-2341s1c1
Sequence:CCGGCGTGACCTTGATTTGGCTTTACTCGAGTAAAGCCAAATCAAGGTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178610.2-932s1c1
Sequence:CCGGGCTCTTACAAAGAGGCAGGAACTCGAGTTCCTGCCTCTTTGTAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178610.2-187s1c1
Sequence:CCGGCGCAACCTTGTTCCCGAAATACTCGAGTATTTCGGGAACAAGGTTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178610.2-825s1c1
Sequence:CCGGAGCCAGAGAGTCAGATTGATACTCGAGTATCAATCTGACTCTCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178610.2-827s1c1
Sequence:CCGGCCAGAGAGTCAGATTGATAAACTCGAGTTTATCAATCTGACTCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178610.4-1041s21c1
Sequence:CCGGGAACGAAACAAAGCGTTTATTCTCGAGAATAAACGCTTTGTTTCGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178610.4-725s21c1
Sequence:CCGGGAAGAATATCCATCCAATTTACTCGAGTAAATTGGATGGATATTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178610.4-571s21c1
Sequence:CCGGAGAGAAGACAGCGGCTTATTGCTCGAGCAATAAGCCGCTGTCTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178610.4-513s21c1
Sequence:CCGGGTTGCGTGTGACATCATTAAACTCGAGTTTAATGATGTCACACGCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178610.4-418s21c1
Sequence:CCGGTTGACCCTTACATCATCATTACTCGAGTAATGATGATGTAAGGGTCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374945    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178610.4-1517s21c1
Sequence:CCGGCCATTGGTTGGTCTTCATAATCTCGAGATTATGAAGACCAACCAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178610
VALIDATED
KRR1 MISSION shRNA shRNA Plasmid DNA
KRR1, small subunit (SSU) processome component, homolog (yeast)
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102255    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178610.2-2341s1c1
Sequence:CCGGCGTGACCTTGATTTGGCTTTACTCGAGTAAAGCCAAATCAAGGTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178610.2-932s1c1
Sequence:CCGGGCTCTTACAAAGAGGCAGGAACTCGAGTTCCTGCCTCTTTGTAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178610.2-187s1c1
Sequence:CCGGCGCAACCTTGTTCCCGAAATACTCGAGTATTTCGGGAACAAGGTTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178610.2-825s1c1
Sequence:CCGGAGCCAGAGAGTCAGATTGATACTCGAGTATCAATCTGACTCTCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178610.2-827s1c1
Sequence:CCGGCCAGAGAGTCAGATTGATAAACTCGAGTTTATCAATCTGACTCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178610.4-1041s21c1
Sequence:CCGGGAACGAAACAAAGCGTTTATTCTCGAGAATAAACGCTTTGTTTCGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178610.4-725s21c1
Sequence:CCGGGAAGAATATCCATCCAATTTACTCGAGTAAATTGGATGGATATTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178610.4-571s21c1
Sequence:CCGGAGAGAAGACAGCGGCTTATTGCTCGAGCAATAAGCCGCTGTCTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178610.4-513s21c1
Sequence:CCGGGTTGCGTGTGACATCATTAAACTCGAGTTTAATGATGTCACACGCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178610.4-418s21c1
Sequence:CCGGTTGACCCTTACATCATCATTACTCGAGTAATGATGATGTAAGGGTCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374945    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178610.4-1517s21c1
Sequence:CCGGCCATTGGTTGGTCTTCATAATCTCGAGATTATGAAGACCAACCAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178610
VALIDATED
KRR1 MISSION shRNA Lentiviral Transduction Particles
KRR1, small subunit (SSU) processome component, homolog (yeast)
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102255    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178610.2-2341s1c1
Sequence:CCGGCGTGACCTTGATTTGGCTTTACTCGAGTAAAGCCAAATCAAGGTCACGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000102256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178610.2-932s1c1
Sequence:CCGGGCTCTTACAAAGAGGCAGGAACTCGAGTTCCTGCCTCTTTGTAAGAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000102258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178610.2-187s1c1
Sequence:CCGGCGCAACCTTGTTCCCGAAATACTCGAGTATTTCGGGAACAAGGTTGCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000102259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178610.2-825s1c1
Sequence:CCGGAGCCAGAGAGTCAGATTGATACTCGAGTATCAATCTGACTCTCTGGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000102257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178610.2-827s1c1
Sequence:CCGGCCAGAGAGTCAGATTGATAAACTCGAGTTTATCAATCTGACTCTCTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000366349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178610.4-1041s21c1
Sequence:CCGGGAACGAAACAAAGCGTTTATTCTCGAGAATAAACGCTTTGTTTCGTTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000375004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178610.4-725s21c1
Sequence:CCGGGAAGAATATCCATCCAATTTACTCGAGTAAATTGGATGGATATTCTTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000376705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178610.4-571s21c1
Sequence:CCGGAGAGAAGACAGCGGCTTATTGCTCGAGCAATAAGCCGCTGTCTTCTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000366297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178610.4-513s21c1
Sequence:CCGGGTTGCGTGTGACATCATTAAACTCGAGTTTAATGATGTCACACGCAACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000375005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178610.4-418s21c1
Sequence:CCGGTTGACCCTTACATCATCATTACTCGAGTAATGATGATGTAAGGGTCAATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000374945    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178610.4-1517s21c1
Sequence:CCGGCCATTGGTTGGTCTTCATAATCTCGAGATTATGAAGACCAACCAATGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007043
VALIDATED
KRR1 MISSION shRNA Bacterial Glycerol Stock
KRR1, small subunit (SSU) processome component, homolog (yeast)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000289497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007043.6-994s21c1
Sequence:CCGGACAAAGCATTTATTCCACCTACTCGAGTAGGTGGAATAAATGCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072293    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007043.5-2121s1c1
Sequence:CCGGGCCTGGATATACAACAGAGTACTCGAGTACTCTGTTGTATATCCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007043.5-968s1c1
Sequence:CCGGACAAAGCATTTATTCCACCTACTCGAGTAGGTGGAATAAATGCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_007043.5-305s1c1
Sequence:CCGGGCAGCATGACTGTTTGTACTACTCGAGTAGTACAAACAGTCATGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_007043.5-259s1c1
Sequence:CCGGGCCTTAAATGAACATCATGTTCTCGAGAACATGATGTTCATTTAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007043.6-331s21c1
Sequence:CCGGGCAGCATGACTGTTTGTACTACTCGAGTAGTACAAACAGTCATGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007043.6-561s21c1
Sequence:CCGGGCATTGGAACTCTTAACTAATCTCGAGATTAGTTAAGAGTTCCAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007043.6-285s21c1
Sequence:CCGGGCCTTAAATGAACATCATGTTCTCGAGAACATGATGTTCATTTAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007043
VALIDATED
KRR1 MISSION shRNA shRNA Plasmid DNA
KRR1, small subunit (SSU) processome component, homolog (yeast)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000289497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007043.6-994s21c1
Sequence:CCGGACAAAGCATTTATTCCACCTACTCGAGTAGGTGGAATAAATGCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072293    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007043.5-2121s1c1
Sequence:CCGGGCCTGGATATACAACAGAGTACTCGAGTACTCTGTTGTATATCCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007043.5-968s1c1
Sequence:CCGGACAAAGCATTTATTCCACCTACTCGAGTAGGTGGAATAAATGCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_007043.5-305s1c1
Sequence:CCGGGCAGCATGACTGTTTGTACTACTCGAGTAGTACAAACAGTCATGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_007043.5-259s1c1
Sequence:CCGGGCCTTAAATGAACATCATGTTCTCGAGAACATGATGTTCATTTAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007043.6-331s21c1
Sequence:CCGGGCAGCATGACTGTTTGTACTACTCGAGTAGTACAAACAGTCATGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007043.6-561s21c1
Sequence:CCGGGCATTGGAACTCTTAACTAATCTCGAGATTAGTTAAGAGTTCCAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007043.6-285s21c1
Sequence:CCGGGCCTTAAATGAACATCATGTTCTCGAGAACATGATGTTCATTTAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007043
VALIDATED
KRR1 MISSION shRNA Lentiviral Transduction Particles
KRR1, small subunit (SSU) processome component, homolog (yeast)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000289497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007043.6-994s21c1
Sequence:CCGGACAAAGCATTTATTCCACCTACTCGAGTAGGTGGAATAAATGCTTTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000072293    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007043.5-2121s1c1
Sequence:CCGGGCCTGGATATACAACAGAGTACTCGAGTACTCTGTTGTATATCCAGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000072297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007043.5-968s1c1
Sequence:CCGGACAAAGCATTTATTCCACCTACTCGAGTAGGTGGAATAAATGCTTTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000072296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_007043.5-305s1c1
Sequence:CCGGGCAGCATGACTGTTTGTACTACTCGAGTAGTACAAACAGTCATGCTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000072294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_007043.5-259s1c1
Sequence:CCGGGCCTTAAATGAACATCATGTTCTCGAGAACATGATGTTCATTTAAGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000289555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007043.6-331s21c1
Sequence:CCGGGCAGCATGACTGTTTGTACTACTCGAGTAGTACAAACAGTCATGCTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000289499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007043.6-561s21c1
Sequence:CCGGGCATTGGAACTCTTAACTAATCTCGAGATTAGTTAAGAGTTCCAATGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000306840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007043.6-285s21c1
Sequence:CCGGGCCTTAAATGAACATCATGTTCTCGAGAACATGATGTTCATTTAAGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???