EMAIL THIS PAGE TO A FRIEND

KRT10

keratin 10

86 Gene Product Result for
Synonyms: BCIE BIE CK10 EHK K10 KPP
UniProtKB ID: P13645, Q14664, Q8N175
Gene ID:
Human(3858) Summary: This gene encodes a member of the type I (acidic) cytokeratin family, which belongs to the superfamily of intermediate filament (IF) proteins. Keratins are heteropolymeric structural proteins which form the intermediate filament. These filaments, along with actin microfilaments and microtubules, compose the cytoskeleton of epithelial cells. Mutations in this gene are associated with epidermolytic hyperkeratosis. This gene is located within a cluster of keratin family members on chromosome 17q21. [provided by RefSeq, Jul 2008]
Mouse(16661) keratin 10
Rat(450225) keratin 10
sheep(101106346) keratin 10
cow(281888) keratin 10
dog(491006) keratin 10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4501656 Anti-Keratin 10 antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunofluorescence, western blot pricing
SAB5500123 Anti-Keratin 10 antibody, Rabbit monoclonal recombinant, expressed in proprietary host, clone SP99, affinity isolated antibody human (tested)
immunohistochemistry pricing
AV41730 Anti-KRT10 antibody produced in rabbit affinity isolated antibody human, rabbit, mouse, dog, horse, rat
western blot pricing
HPA012014 Anti-KRT10 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunohistochemistry pricing
C2562 Monoclonal Anti-Cytokeratin, pan (Mixture) antibody produced in mouse clone C-11+PCK-26+CY-90+KS-1A3+M20+A53-B/A2, ascites fluid wide range
immunofluorescence, immunohistochemistry, western blot pricing
C9687 Monoclonal Anti-Cytokeratin, pan (Mixture) Prediluted antibody produced in mouse clone C-11+PCK-26+CY-90+KS-1A3+M20+A53-B/A2, ascites fluid wide range
immunohistochemistry pricing
C2931 Monoclonal Anti-Cytokeratin, pan antibody produced in mouse clone C-11, ascites fluid bovine, frog, rat, human, kangaroo rat, mouse
immunofluorescence, immunohistochemistry, western blot pricing
P2871 Monoclonal Anti-Cytokeratin, pan antibody produced in mouse clone C-11, purified immunoglobulin, buffered aqueous solution bovine, frog, rat, human, kangaroo rat, mouse
immunocytochemistry, immunohistochemistry, microarray, western blot pricing
F3418 Monoclonal Anti-Cytokeratin, pan−FITC antibody produced in mouse clone C-11, purified immunoglobulin, buffered aqueous solution bovine, frog, rat, human, kangaroo rat, mouse
immunofluorescence, immunohistochemistry, western blot pricing
WH0003858M1 Monoclonal Anti-KRT10 antibody produced in mouse clone 1H6, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010660 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010660 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010660 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000421 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000421 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000421 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000421 Rosetta Predictions human pricing
NM_001008804 Rosetta Predictions rat pricing
NM_010660 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000421 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00184972 predicted 978
2 SASI_Hs01_00184973 predicted 581
3 SASI_Hs01_00184974 predicted 1044
4 SASI_Hs01_00184976 predicted 520
5 SASI_Hs02_00302519 predicted 584
6 SASI_Hs01_00184978 predicted 836
7 SASI_Hs01_00184980 predicted 1067
8 SASI_Hs02_00302520 predicted 1111
9 SASI_Hs02_00302521 predicted 944
10 SASI_Hs02_00302522 predicted 1046
11 SASI_Hs01_00184975 predicted 1079
12 SASI_Hs01_00184977 predicted 1091
13 SASI_Hs01_00184979 predicted 638
14 SASI_Hs01_00184981 predicted 650
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008804 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00113311 predicted 809
2 SASI_Rn01_00113312 predicted 1285
3 SASI_Rn01_00113313 predicted 501
4 SASI_Rn01_00113314 predicted 857
5 SASI_Rn01_00113315 predicted 572
6 SASI_Rn01_00113316 predicted 965
7 SASI_Rn01_00113317 predicted 1053
8 SASI_Rn01_00113318 predicted 629
9 SASI_Rn01_00113319 predicted 1067
10 SASI_Rn01_00113320 predicted 272
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010660 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00319065 predicted 865
2 SASI_Mm01_00096706 predicted 958
3 SASI_Mm02_00319066 predicted 353
4 SASI_Mm02_00319067 predicted 210
5 SASI_Mm02_00319068 predicted 1770
6 SASI_Mm02_00319069 predicted 1076
7 SASI_Mm02_00319070 predicted 1775
8 SASI_Mm02_00319071 predicted 862
9 SASI_Mm02_00319072 predicted 1801
10 SASI_Mm02_00319073 predicted 957
11 SASI_Mm01_00096704 predicted 820
12 SASI_Mm01_00096705 predicted 1031
13 SASI_Mm01_00096707 predicted 878
14 SASI_Mm01_00096708 predicted 646
15 SASI_Mm01_00096709 predicted 1140
16 SASI_Mm01_00096710 predicted 920
17 SASI_Mm01_00096711 predicted 1025
18 SASI_Mm01_00096712 predicted 669
19 SASI_Mm01_00096713 predicted 673
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010660
KRT10 MISSION shRNA Bacterial Glycerol Stock
keratin 10
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091318    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010660.1-1746s1c1
Sequence:CCGGCCAAAGTGATTAGGACGATTACTCGAGTAATCGTCCTAATCACTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010660.1-597s1c1
Sequence:CCGGCCGGGACTACAGCAAATACTACTCGAGTAGTATTTGCTGTAGTCCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010660.1-1094s1c1
Sequence:CCGGCCAGCCATAAGTCTGAAATCACTCGAGTGATTTCAGACTTATGGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010660.1-1198s1c1
Sequence:CCGGGCAGAAACAGTAGAGTCGCTACTCGAGTAGCGACTCTACTGTTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010660.1-1071s1c1
Sequence:CCGGCGACAGCAACATTGCACAAATCTCGAGATTTGTGCAATGTTGCTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366834    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010660.2-1923s21c1
Sequence:CCGGTCCTTGAAATTAAGGTCTAAACTCGAGTTTAGACCTTAATTTCAAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375664    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010660.2-1725s21c1
Sequence:CCGGCAAAGTGATCAGGACGATTATCTCGAGATAATCGTCCTGATCACTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010660.2-700s21c1
Sequence:CCGGTCAGGCTGAAATACGAGAATGCTCGAGCATTCTCGTATTTCAGCCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010660.2-1684s21c1
Sequence:CCGGGCGGCGACCAATCATCTAAAGCTCGAGCTTTAGATGATTGGTCGCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010660.2-1243s21c1
Sequence:CCGGAGGAACAGCTGCAACAGATTCCTCGAGGAATCTGTTGCAGCTGTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010660.2-830s21c1
Sequence:CCGGCGAAGAGCTGGCCTACCTAAACTCGAGTTTAGGTAGGCCAGCTCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010660.2-1052s21c1
Sequence:CCGGCGACAGCAACATTGAACAAATCTCGAGATTTGTTCAATGTTGCTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010660.2-131s21c1
Sequence:CCGGCTCTCTTGGTGGAGGGTATAGCTCGAGCTATACCCTCCACCAAGAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010660
KRT10 MISSION shRNA shRNA Plasmid DNA
keratin 10
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091318    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010660.1-1746s1c1
Sequence:CCGGCCAAAGTGATTAGGACGATTACTCGAGTAATCGTCCTAATCACTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010660.1-597s1c1
Sequence:CCGGCCGGGACTACAGCAAATACTACTCGAGTAGTATTTGCTGTAGTCCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010660.1-1094s1c1
Sequence:CCGGCCAGCCATAAGTCTGAAATCACTCGAGTGATTTCAGACTTATGGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010660.1-1198s1c1
Sequence:CCGGGCAGAAACAGTAGAGTCGCTACTCGAGTAGCGACTCTACTGTTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010660.1-1071s1c1
Sequence:CCGGCGACAGCAACATTGCACAAATCTCGAGATTTGTGCAATGTTGCTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366834    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010660.2-1923s21c1
Sequence:CCGGTCCTTGAAATTAAGGTCTAAACTCGAGTTTAGACCTTAATTTCAAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375664    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010660.2-1725s21c1
Sequence:CCGGCAAAGTGATCAGGACGATTATCTCGAGATAATCGTCCTGATCACTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010660.2-700s21c1
Sequence:CCGGTCAGGCTGAAATACGAGAATGCTCGAGCATTCTCGTATTTCAGCCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010660.2-1684s21c1
Sequence:CCGGGCGGCGACCAATCATCTAAAGCTCGAGCTTTAGATGATTGGTCGCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010660.2-1243s21c1
Sequence:CCGGAGGAACAGCTGCAACAGATTCCTCGAGGAATCTGTTGCAGCTGTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010660.2-830s21c1
Sequence:CCGGCGAAGAGCTGGCCTACCTAAACTCGAGTTTAGGTAGGCCAGCTCTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010660.2-1052s21c1
Sequence:CCGGCGACAGCAACATTGAACAAATCTCGAGATTTGTTCAATGTTGCTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010660.2-131s21c1
Sequence:CCGGCTCTCTTGGTGGAGGGTATAGCTCGAGCTATACCCTCCACCAAGAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010660
KRT10 MISSION shRNA Lentiviral Transduction Particles
keratin 10
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091318    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010660.1-1746s1c1
Sequence:CCGGCCAAAGTGATTAGGACGATTACTCGAGTAATCGTCCTAATCACTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010660.1-597s1c1
Sequence:CCGGCCGGGACTACAGCAAATACTACTCGAGTAGTATTTGCTGTAGTCCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010660.1-1094s1c1
Sequence:CCGGCCAGCCATAAGTCTGAAATCACTCGAGTGATTTCAGACTTATGGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010660.1-1198s1c1
Sequence:CCGGGCAGAAACAGTAGAGTCGCTACTCGAGTAGCGACTCTACTGTTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010660.1-1071s1c1
Sequence:CCGGCGACAGCAACATTGCACAAATCTCGAGATTTGTGCAATGTTGCTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366834    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010660.2-1923s21c1
Sequence:CCGGTCCTTGAAATTAAGGTCTAAACTCGAGTTTAGACCTTAATTTCAAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375664    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010660.2-1725s21c1
Sequence:CCGGCAAAGTGATCAGGACGATTATCTCGAGATAATCGTCCTGATCACTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010660.2-700s21c1
Sequence:CCGGTCAGGCTGAAATACGAGAATGCTCGAGCATTCTCGTATTTCAGCCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010660.2-1684s21c1
Sequence:CCGGGCGGCGACCAATCATCTAAAGCTCGAGCTTTAGATGATTGGTCGCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010660.2-1243s21c1
Sequence:CCGGAGGAACAGCTGCAACAGATTCCTCGAGGAATCTGTTGCAGCTGTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010660.2-830s21c1
Sequence:CCGGCGAAGAGCTGGCCTACCTAAACTCGAGTTTAGGTAGGCCAGCTCTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010660.2-1052s21c1
Sequence:CCGGCGACAGCAACATTGAACAAATCTCGAGATTTGTTCAATGTTGCTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010660.2-131s21c1
Sequence:CCGGCTCTCTTGGTGGAGGGTATAGCTCGAGCTATACCCTCCACCAAGAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000421
VALIDATED
KRT10 MISSION shRNA Bacterial Glycerol Stock
keratin 10
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083473    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000421.2-1771s1c1
Sequence:CCGGCCAGAGTAATCAAGACAATTACTCGAGTAATTGTCTTGATTACTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_000421.2-1085s1c1
Sequence:CCGGTCCAGCTATAAATCTGAGATTCTCGAGAATCTCAGATTTATAGCTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_000421.2-1086s1c1
Sequence:CCGGCCAGCTATAAATCTGAGATTACTCGAGTAATCTCAGATTTATAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000421.2-586s1c1
Sequence:CCGGGCCTCGTGACTACAGCAAATACTCGAGTATTTGCTGTAGTCACGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_000421.2-1331s1c1
Sequence:CCGGCGACTGGAGAATGAAATTCAACTCGAGTTGAATTTCATTCTCCAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000421.3-1102s21c1
Sequence:CCGGCCAGCTATAAATCTGAGATTACTCGAGTAATCTCAGATTTATAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333533    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000421.3-1787s21c1
Sequence:CCGGCCAGAGTAATCAAGACAATTACTCGAGTAATTGTCTTGATTACTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000421.3-1347s21c1
Sequence:CCGGCGACTGGAGAATGAAATTCAACTCGAGTTGAATTTCATTCTCCAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000421.3-1322s21c1
Sequence:CCGGCCAACAACTCCTGGATATTAACTCGAGTTAATATCCAGGAGTTGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000421
VALIDATED
KRT10 MISSION shRNA shRNA Plasmid DNA
keratin 10
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083473    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000421.2-1771s1c1
Sequence:CCGGCCAGAGTAATCAAGACAATTACTCGAGTAATTGTCTTGATTACTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_000421.2-1085s1c1
Sequence:CCGGTCCAGCTATAAATCTGAGATTCTCGAGAATCTCAGATTTATAGCTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_000421.2-1086s1c1
Sequence:CCGGCCAGCTATAAATCTGAGATTACTCGAGTAATCTCAGATTTATAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000421.2-586s1c1
Sequence:CCGGGCCTCGTGACTACAGCAAATACTCGAGTATTTGCTGTAGTCACGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_000421.2-1331s1c1
Sequence:CCGGCGACTGGAGAATGAAATTCAACTCGAGTTGAATTTCATTCTCCAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000421.3-1102s21c1
Sequence:CCGGCCAGCTATAAATCTGAGATTACTCGAGTAATCTCAGATTTATAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333533    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000421.3-1787s21c1
Sequence:CCGGCCAGAGTAATCAAGACAATTACTCGAGTAATTGTCTTGATTACTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000421.3-1347s21c1
Sequence:CCGGCGACTGGAGAATGAAATTCAACTCGAGTTGAATTTCATTCTCCAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000421.3-1322s21c1
Sequence:CCGGCCAACAACTCCTGGATATTAACTCGAGTTAATATCCAGGAGTTGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000421
VALIDATED
KRT10 MISSION shRNA Lentiviral Transduction Particles
keratin 10
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083473    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000421.2-1771s1c1
Sequence:CCGGCCAGAGTAATCAAGACAATTACTCGAGTAATTGTCTTGATTACTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_000421.2-1085s1c1
Sequence:CCGGTCCAGCTATAAATCTGAGATTCTCGAGAATCTCAGATTTATAGCTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_000421.2-1086s1c1
Sequence:CCGGCCAGCTATAAATCTGAGATTACTCGAGTAATCTCAGATTTATAGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000421.2-586s1c1
Sequence:CCGGGCCTCGTGACTACAGCAAATACTCGAGTATTTGCTGTAGTCACGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_000421.2-1331s1c1
Sequence:CCGGCGACTGGAGAATGAAATTCAACTCGAGTTGAATTTCATTCTCCAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000421.3-1102s21c1
Sequence:CCGGCCAGCTATAAATCTGAGATTACTCGAGTAATCTCAGATTTATAGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333533    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000421.3-1787s21c1
Sequence:CCGGCCAGAGTAATCAAGACAATTACTCGAGTAATTGTCTTGATTACTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000421.3-1347s21c1
Sequence:CCGGCGACTGGAGAATGAAATTCAACTCGAGTTGAATTTCATTCTCCAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000421.3-1322s21c1
Sequence:CCGGCCAACAACTCCTGGATATTAACTCGAGTTAATATCCAGGAGTTGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)