EMAIL THIS PAGE TO A FRIEND

KRT12

keratin 12

87 Gene Product Result for
Synonyms: K12
UniProtKB ID: Q99456, B2R9E0
Gene ID:
Human(3859) Summary: KRT12 encodes the type I intermediate filament chain keratin 12, expressed in corneal epithelia. Mutations in this gene lead to Meesmann corneal dystrophy. [provided by RefSeq, Jul 2008]
Mouse(268482) keratin 12
Rat(360625) keratin 12
chicken(428314) keratin 12 (Meesmann corneal dystrophy)
dog(100034663) keratin 12
cow(788382) keratin 12
sheep(101106606) keratin 12
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000223 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000223 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000223 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010661 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010661 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010661 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU018211 MISSION® esiRNA esiRNA targeting human KRT12 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000223 Rosetta Predictions human pricing
NM_001008761 Rosetta Predictions rat pricing
XM_579209 Rosetta Predictions rat pricing
NM_010661 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000223 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00032709 predicted 1544
2 SASI_Hs01_00032710 predicted 1466
3 SASI_Hs01_00032711 predicted 549
4 SASI_Hs01_00032712 predicted 1387
5 SASI_Hs01_00032713 predicted 1402
6 SASI_Hs02_00302120 predicted 560
7 SASI_Hs01_00032714 predicted 264
8 SASI_Hs01_00032715 predicted 467
9 SASI_Hs01_00032717 predicted 1152
10 SASI_Hs02_00302121 predicted 566
11 SASI_Hs01_00032716 predicted 636
12 SASI_Hs01_00032718 predicted 1406
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008761 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00086275 predicted 590
2 SASI_Rn01_00086276 predicted 479
3 SASI_Rn01_00086277 predicted 474
4 SASI_Rn02_00199261 predicted 372
5 SASI_Rn01_00086278 predicted 997
6 SASI_Rn01_00086280 predicted 1081
7 SASI_Rn01_00086281 predicted 444
8 SASI_Rn01_00086282 predicted 443
9 SASI_Rn01_00086283 predicted 515
10 SASI_Rn01_00086284 predicted 1130
11 SASI_Rn01_00086279 predicted 445
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579209 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00196306 predicted 604
2 SASI_Rn01_00196307 predicted 489
3 SASI_Rn01_00196308 predicted 479
4 SASI_Rn01_00196309 predicted 449
5 SASI_Rn01_00196310 predicted 445
6 SASI_Rn01_00196311 predicted 519
7 SASI_Rn01_00196312 predicted 516
8 SASI_Rn01_00196313 predicted 510
9 SASI_Rn01_00196314 predicted 606
10 SASI_Rn01_00196315 predicted 938
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010661 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00049703 predicted 455
2 SASI_Mm02_00319074 predicted 1391
3 SASI_Mm01_00049705 predicted 533
4 SASI_Mm02_00319075 predicted 1547
5 SASI_Mm01_00049708 predicted 459
6 SASI_Mm01_00049709 predicted 200
7 SASI_Mm02_00319076 predicted 558
8 SASI_Mm01_00049710 predicted 211
9 SASI_Mm02_00319077 predicted 1449
10 SASI_Mm02_00319078 predicted 1445
11 SASI_Mm01_00049704 predicted 558
12 SASI_Mm01_00049706 predicted 298
13 SASI_Mm01_00049707 predicted 1585
14 SASI_Mm01_00049711 predicted 1445
15 SASI_Mm01_00049712 predicted 706
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000223
KRT12 MISSION shRNA Bacterial Glycerol Stock
keratin 12
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000223.3-861s21c1
Sequence:CCGGAGGCGAGGTCAGCGTAGAAATCTCGAGATTTCTACGCTGACCTCGCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427056    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000223.3-1808s21c1
Sequence:CCGGGAGCTTTAATCAAGTAGTATTCTCGAGAATACTACTTGATTAAAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000223.3-579s21c1
Sequence:CCGGCCTCAGGAATAAGATCATTTCCTCGAGGAAATGATCTTATTCCTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000223.3-532s21c1
Sequence:CCGGGATGCTTCACAGAGCGATTACCTCGAGGTAATCGCTCTGTGAAGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000223.1-203s1c1
Sequence:CCGGCTTCCATGTTTGGTTCTAGTTCTCGAGAACTAGAACCAAACATGGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000223.1-1005s1c1
Sequence:CCGGCCGTAAGGAGATTAGCACCAACTCGAGTTGGTGCTAATCTCCTTACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000223.1-1402s1c1
Sequence:CCGGTCCTCTAAAGACCCAACCAAACTCGAGTTTGGTTGGGTCTTTAGAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000223.1-454s1c1
Sequence:CCGGCGAGCTCTAGAAGAGGCTAATCTCGAGATTAGCCTCTTCTAGAGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000223.1-380s1c1
Sequence:CCGGGCCTTCTTTCTGGATCAGAAACTCGAGTTTCTGATCCAGAAAGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000223
KRT12 MISSION shRNA shRNA Plasmid DNA
keratin 12
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000223.3-861s21c1
Sequence:CCGGAGGCGAGGTCAGCGTAGAAATCTCGAGATTTCTACGCTGACCTCGCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427056    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000223.3-1808s21c1
Sequence:CCGGGAGCTTTAATCAAGTAGTATTCTCGAGAATACTACTTGATTAAAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000223.3-579s21c1
Sequence:CCGGCCTCAGGAATAAGATCATTTCCTCGAGGAAATGATCTTATTCCTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000223.3-532s21c1
Sequence:CCGGGATGCTTCACAGAGCGATTACCTCGAGGTAATCGCTCTGTGAAGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000223.1-203s1c1
Sequence:CCGGCTTCCATGTTTGGTTCTAGTTCTCGAGAACTAGAACCAAACATGGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000223.1-1005s1c1
Sequence:CCGGCCGTAAGGAGATTAGCACCAACTCGAGTTGGTGCTAATCTCCTTACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000223.1-1402s1c1
Sequence:CCGGTCCTCTAAAGACCCAACCAAACTCGAGTTTGGTTGGGTCTTTAGAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000223.1-454s1c1
Sequence:CCGGCGAGCTCTAGAAGAGGCTAATCTCGAGATTAGCCTCTTCTAGAGCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000223.1-380s1c1
Sequence:CCGGGCCTTCTTTCTGGATCAGAAACTCGAGTTTCTGATCCAGAAAGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000223
KRT12 MISSION shRNA Lentiviral Transduction Particles
keratin 12
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000223.3-861s21c1
Sequence:CCGGAGGCGAGGTCAGCGTAGAAATCTCGAGATTTCTACGCTGACCTCGCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427056    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000223.3-1808s21c1
Sequence:CCGGGAGCTTTAATCAAGTAGTATTCTCGAGAATACTACTTGATTAAAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000223.3-579s21c1
Sequence:CCGGCCTCAGGAATAAGATCATTTCCTCGAGGAAATGATCTTATTCCTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000223.3-532s21c1
Sequence:CCGGGATGCTTCACAGAGCGATTACCTCGAGGTAATCGCTCTGTGAAGCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000223.1-203s1c1
Sequence:CCGGCTTCCATGTTTGGTTCTAGTTCTCGAGAACTAGAACCAAACATGGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000223.1-1005s1c1
Sequence:CCGGCCGTAAGGAGATTAGCACCAACTCGAGTTGGTGCTAATCTCCTTACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000223.1-1402s1c1
Sequence:CCGGTCCTCTAAAGACCCAACCAAACTCGAGTTTGGTTGGGTCTTTAGAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000223.1-454s1c1
Sequence:CCGGCGAGCTCTAGAAGAGGCTAATCTCGAGATTAGCCTCTTCTAGAGCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000223.1-380s1c1
Sequence:CCGGGCCTTCTTTCTGGATCAGAAACTCGAGTTTCTGATCCAGAAAGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010661
KRT12 MISSION shRNA Bacterial Glycerol Stock
keratin 12
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437551    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010661.2-1554s21c1
Sequence:CCGGTACTGCTTCCGTGCGCTATATCTCGAGATATAGCGCACGGAAGCAGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010661.2-1366s21c1
Sequence:CCGGTTCTGTCTCCAAACCGCAGACCTCGAGGTCTGCGGTTTGGAGACAGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090028    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010661.1-1565s1c1
Sequence:CCGGCGCTATATTGATTCAGCACCTCTCGAGAGGTGCTGAATCAATATAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010661.1-1385s1c1
Sequence:CCGGCCATCAGTCGATTCCTCTAAACTCGAGTTTAGAGGAATCGACTGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010661.1-464s1c1
Sequence:CCGGGAGGCTAATGCAGAACTGGAACTCGAGTTCCAGTTCTGCATTAGCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010661.1-910s1c1
Sequence:CCGGCCTCAATGAAATGAGAGCCCACTCGAGTGGGCTCTCATTTCATTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010661.1-559s1c1
Sequence:CCGGCCCACTGATTGAAGACTTGAACTCGAGTTCAAGTCTTCAATCAGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010661
KRT12 MISSION shRNA shRNA Plasmid DNA
keratin 12
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437551    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010661.2-1554s21c1
Sequence:CCGGTACTGCTTCCGTGCGCTATATCTCGAGATATAGCGCACGGAAGCAGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010661.2-1366s21c1
Sequence:CCGGTTCTGTCTCCAAACCGCAGACCTCGAGGTCTGCGGTTTGGAGACAGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090028    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010661.1-1565s1c1
Sequence:CCGGCGCTATATTGATTCAGCACCTCTCGAGAGGTGCTGAATCAATATAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010661.1-1385s1c1
Sequence:CCGGCCATCAGTCGATTCCTCTAAACTCGAGTTTAGAGGAATCGACTGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010661.1-464s1c1
Sequence:CCGGGAGGCTAATGCAGAACTGGAACTCGAGTTCCAGTTCTGCATTAGCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010661.1-910s1c1
Sequence:CCGGCCTCAATGAAATGAGAGCCCACTCGAGTGGGCTCTCATTTCATTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010661.1-559s1c1
Sequence:CCGGCCCACTGATTGAAGACTTGAACTCGAGTTCAAGTCTTCAATCAGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010661
KRT12 MISSION shRNA Lentiviral Transduction Particles
keratin 12
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437551    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010661.2-1554s21c1
Sequence:CCGGTACTGCTTCCGTGCGCTATATCTCGAGATATAGCGCACGGAAGCAGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010661.2-1366s21c1
Sequence:CCGGTTCTGTCTCCAAACCGCAGACCTCGAGGTCTGCGGTTTGGAGACAGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090028    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010661.1-1565s1c1
Sequence:CCGGCGCTATATTGATTCAGCACCTCTCGAGAGGTGCTGAATCAATATAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010661.1-1385s1c1
Sequence:CCGGCCATCAGTCGATTCCTCTAAACTCGAGTTTAGAGGAATCGACTGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010661.1-464s1c1
Sequence:CCGGGAGGCTAATGCAGAACTGGAACTCGAGTTCCAGTTCTGCATTAGCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010661.1-910s1c1
Sequence:CCGGCCTCAATGAAATGAGAGCCCACTCGAGTGGGCTCTCATTTCATTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010661.1-559s1c1
Sequence:CCGGCCCACTGATTGAAGACTTGAACTCGAGTTCAAGTCTTCAATCAGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)