EMAIL THIS PAGE TO A FRIEND

KRT13

keratin 13

84 Gene Product Result for
Synonyms: CK13 K13
UniProtKB ID: P13646, Q53G54, Q6AZK5, Q8N240
Gene ID:
Human(3860) Summary: The protein encoded by this gene is a member of the keratin gene family. The keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into cytokeratins and hair keratins. Most of the type I cytokeratins consist of acidic proteins which are arranged in pairs of heterotypic keratin chains. This type I cytokeratin is paired with keratin 4 and expressed in the suprabasal layers of non-cornified stratified epithelia. Mutations in this gene and keratin 4 have been associated with the autosomal dominant disorder White Sponge Nevus. The type I cytokeratins are clustered in a region of chromosome 17q21.2. Alternative splicing of this gene results in multiple transcript variants; however, not all variants have been described. [provided by RefSeq, Jul 2008]
Mouse(16663) keratin 13
Rat(287699) keratin 13
cow(100296555) keratin 13
dog(490983) keratin 13
sheep(101117431) keratin 13
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2500577 Anti-KRT13 antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
AV42031 Anti-KRT13 antibody produced in rabbit IgG fraction of antiserum rat, rabbit, canine, sheep, human, bovine, guinea pig, mouse, zebrafish, horse,
immunohistochemistry, western blot pricing
HPA030877 Anti-KRT13 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2104755 Anti-KRT13, (N-terminal) antibody produced in rabbit affinity isolated antibody sheep, horse, human, rabbit
western blot pricing
C0791 Monoclonal Anti-Cytokeratin Peptide 13 antibody produced in mouse clone KS-1A3, ascites fluid human
immunofluorescence, immunohistochemistry, microarray pricing
C2562 Monoclonal Anti-Cytokeratin, pan (Mixture) antibody produced in mouse clone C-11+PCK-26+CY-90+KS-1A3+M20+A53-B/A2, ascites fluid wide range
immunofluorescence, immunohistochemistry, western blot pricing
C9687 Monoclonal Anti-Cytokeratin, pan (Mixture) Prediluted antibody produced in mouse clone C-11+PCK-26+CY-90+KS-1A3+M20+A53-B/A2, ascites fluid wide range
immunohistochemistry pricing
C2931 Monoclonal Anti-Cytokeratin, pan antibody produced in mouse clone C-11, ascites fluid bovine, frog, rat, human, kangaroo rat, mouse
immunofluorescence, immunohistochemistry, western blot pricing
P2871 Monoclonal Anti-Cytokeratin, pan antibody produced in mouse clone C-11, purified immunoglobulin, buffered aqueous solution bovine, frog, rat, human, kangaroo rat, mouse
immunocytochemistry, immunohistochemistry, microarray, western blot pricing
F3418 Monoclonal Anti-Cytokeratin, pan−FITC antibody produced in mouse clone C-11, purified immunoglobulin, buffered aqueous solution bovine, frog, rat, human, kangaroo rat, mouse
immunofluorescence, immunohistochemistry, western blot pricing
SAB1402831 Monoclonal Anti-KRT13 antibody produced in mouse clone 4F5, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010662 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010662 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010662 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002274 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002274 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002274 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002274 Rosetta Predictions human pricing
NM_153490 Rosetta Predictions human pricing
NM_001004021 Rosetta Predictions rat pricing
XM_579117 Rosetta Predictions rat pricing
NM_010662 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002274 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00220782 predicted 739
2 SASI_Hs01_00220783 predicted 985
3 SASI_Hs01_00220784 predicted 793
4 SASI_Hs01_00220785 predicted 552
5 SASI_Hs01_00220787 predicted 990
6 SASI_Hs01_00220788 predicted 955
7 SASI_Hs01_00220790 predicted 973
8 SASI_Hs02_00333552 predicted 960
9 SASI_Hs02_00333553 predicted 999
10 SASI_Hs02_00333554 predicted 704
11 SASI_Hs01_00220786 predicted 898
12 SASI_Hs01_00220789 predicted 586
13 SASI_Hs01_00220791 predicted 624
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153490 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00066818 predicted 746
2 SASI_Hs01_00066819 predicted 981
3 SASI_Hs01_00066820 predicted 797
4 SASI_Hs01_00066821 predicted 555
5 SASI_Hs01_00066823 predicted 993
6 SASI_Hs01_00066824 predicted 948
7 SASI_Hs01_00066826 predicted 977
8 SASI_Hs02_00367314 predicted 957
9 SASI_Hs02_00367315 predicted 997
10 SASI_Hs02_00367316 predicted 708
11 SASI_Hs01_00066822 predicted 897
12 SASI_Hs01_00066825 predicted 591
13 SASI_Hs01_00066827 predicted 625
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004021 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00080064 predicted 707
2 SASI_Rn01_00080065 predicted 498
3 SASI_Rn01_00080066 predicted 416
4 SASI_Rn01_00080067 predicted 531
5 SASI_Rn01_00080068 predicted 418
6 SASI_Rn02_00198087 predicted 359
7 SASI_Rn02_00198088 predicted 358
8 SASI_Rn01_00080069 predicted 358
9 SASI_Rn01_00080070 predicted 426
10 SASI_Rn01_00080072 predicted 420
11 SASI_Rn01_00080071 predicted 361
12 SASI_Rn01_00080073 predicted 477
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579117 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00177577 predicted 708
2 SASI_Rn01_00177578 predicted 501
3 SASI_Rn01_00177579 predicted 423
4 SASI_Rn01_00177580 predicted 531
5 SASI_Rn01_00177581 predicted 429
6 SASI_Rn01_00177582 predicted 361
7 SASI_Rn01_00177583 predicted 430
8 SASI_Rn01_00177584 predicted 359
9 SASI_Rn01_00177585 predicted 425
10 SASI_Rn01_00177586 predicted 483
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010662 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00156251 predicted 711
2 SASI_Mm01_00156252 predicted 635
3 SASI_Mm01_00156253 predicted 407
4 SASI_Mm01_00156254 predicted 1006
5 SASI_Mm01_00156255 predicted 377
6 SASI_Mm01_00156256 predicted 390
7 SASI_Mm01_00156257 predicted 563
8 SASI_Mm01_00156258 predicted 872
9 SASI_Mm02_00319079 predicted 211
10 SASI_Mm01_00156260 predicted 484
11 SASI_Mm01_00156259 predicted 918
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010662
KRT13 MISSION shRNA Bacterial Glycerol Stock
keratin 13
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010662.1-423s1c1
Sequence:CCGGGCGGGACTACAGTGCTTATTACTCGAGTAATAAGCACTGTAGTCCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010662.1-829s1c1
Sequence:CCGGGCAGAGAAGAATCGGAGGGATCTCGAGATCCCTCCGATTCTTCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010662.1-27s1c1
Sequence:CCGGCATGAGCTATGGAGGTGGTTTCTCGAGAAACCACCTCCATAGCTCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010662.1-1131s1c1
Sequence:CCGGCCAGGAATACAAGATGCTGTTCTCGAGAACAGCATCTTGTATTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010662.1-668s1c1
Sequence:CCGGGCCTGAATGAAGAACTGGCTTCTCGAGAAGCCAGTTCTTCATTCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010662.1-1230s21c1
Sequence:CCGGCTTCAACTCCGGAGGAAATAACTCGAGTTATTTCCTCCGGAGTTGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010662.1-1281s21c1
Sequence:CCGGCAATTCCGGTCGCCCAGATTTCTCGAGAAATCTGGGCGACCGGAATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010662.1-894s21c1
Sequence:CCGGAGTATCCTCCAACGCTGAAATCTCGAGATTTCAGCGTTGGAGGATACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010662
KRT13 MISSION shRNA shRNA Plasmid DNA
keratin 13
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010662.1-423s1c1
Sequence:CCGGGCGGGACTACAGTGCTTATTACTCGAGTAATAAGCACTGTAGTCCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010662.1-829s1c1
Sequence:CCGGGCAGAGAAGAATCGGAGGGATCTCGAGATCCCTCCGATTCTTCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010662.1-27s1c1
Sequence:CCGGCATGAGCTATGGAGGTGGTTTCTCGAGAAACCACCTCCATAGCTCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010662.1-1131s1c1
Sequence:CCGGCCAGGAATACAAGATGCTGTTCTCGAGAACAGCATCTTGTATTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010662.1-668s1c1
Sequence:CCGGGCCTGAATGAAGAACTGGCTTCTCGAGAAGCCAGTTCTTCATTCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010662.1-1230s21c1
Sequence:CCGGCTTCAACTCCGGAGGAAATAACTCGAGTTATTTCCTCCGGAGTTGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010662.1-1281s21c1
Sequence:CCGGCAATTCCGGTCGCCCAGATTTCTCGAGAAATCTGGGCGACCGGAATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010662.1-894s21c1
Sequence:CCGGAGTATCCTCCAACGCTGAAATCTCGAGATTTCAGCGTTGGAGGATACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010662
KRT13 MISSION shRNA Lentiviral Transduction Particles
keratin 13
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010662.1-423s1c1
Sequence:CCGGGCGGGACTACAGTGCTTATTACTCGAGTAATAAGCACTGTAGTCCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010662.1-829s1c1
Sequence:CCGGGCAGAGAAGAATCGGAGGGATCTCGAGATCCCTCCGATTCTTCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010662.1-27s1c1
Sequence:CCGGCATGAGCTATGGAGGTGGTTTCTCGAGAAACCACCTCCATAGCTCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010662.1-1131s1c1
Sequence:CCGGCCAGGAATACAAGATGCTGTTCTCGAGAACAGCATCTTGTATTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010662.1-668s1c1
Sequence:CCGGGCCTGAATGAAGAACTGGCTTCTCGAGAAGCCAGTTCTTCATTCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010662.1-1230s21c1
Sequence:CCGGCTTCAACTCCGGAGGAAATAACTCGAGTTATTTCCTCCGGAGTTGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010662.1-1281s21c1
Sequence:CCGGCAATTCCGGTCGCCCAGATTTCTCGAGAAATCTGGGCGACCGGAATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010662.1-894s21c1
Sequence:CCGGAGTATCCTCCAACGCTGAAATCTCGAGATTTCAGCGTTGGAGGATACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002274
KRT13 MISSION shRNA Bacterial Glycerol Stock
keratin 13
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002274.2-319s1c1
Sequence:CCGGGCTGGTGGCTTTGTTGACTTTCTCGAGAAAGTCAACAAAGCCACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002274.2-772s1c1
Sequence:CCGGGCCTACATGAAGAAGAACCATCTCGAGATGGTTCTTCTTCATGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002274.2-589s1c1
Sequence:CCGGGTCATCCTGGAGATTGACAATCTCGAGATTGTCAATCTCCAGGATGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002274.2-143s1c1
Sequence:CCGGGTGGTGTCTCTACCTGTTCAACTCGAGTTGAACAGGTAGAGACACCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002274.2-523s1c1
Sequence:CCGGCCCTACTACAAGACCATTGAACTCGAGTTCAATGGTCTTGTAGTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414223    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002274.3-1396s21c1
Sequence:CCGGTGATGTCCGTAGGCCTTAAATCTCGAGATTTAAGGCCTACGGACATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002274.3-941s21c1
Sequence:CCGGAGGAATGGTTCCACGCCAAGACTCGAGTCTTGGCGTGGAACCATTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002274
KRT13 MISSION shRNA shRNA Plasmid DNA
keratin 13
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002274.2-319s1c1
Sequence:CCGGGCTGGTGGCTTTGTTGACTTTCTCGAGAAAGTCAACAAAGCCACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002274.2-772s1c1
Sequence:CCGGGCCTACATGAAGAAGAACCATCTCGAGATGGTTCTTCTTCATGTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002274.2-589s1c1
Sequence:CCGGGTCATCCTGGAGATTGACAATCTCGAGATTGTCAATCTCCAGGATGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002274.2-143s1c1
Sequence:CCGGGTGGTGTCTCTACCTGTTCAACTCGAGTTGAACAGGTAGAGACACCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002274.2-523s1c1
Sequence:CCGGCCCTACTACAAGACCATTGAACTCGAGTTCAATGGTCTTGTAGTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414223    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002274.3-1396s21c1
Sequence:CCGGTGATGTCCGTAGGCCTTAAATCTCGAGATTTAAGGCCTACGGACATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002274.3-941s21c1
Sequence:CCGGAGGAATGGTTCCACGCCAAGACTCGAGTCTTGGCGTGGAACCATTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002274
KRT13 MISSION shRNA Lentiviral Transduction Particles
keratin 13
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002274.2-319s1c1
Sequence:CCGGGCTGGTGGCTTTGTTGACTTTCTCGAGAAAGTCAACAAAGCCACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002274.2-772s1c1
Sequence:CCGGGCCTACATGAAGAAGAACCATCTCGAGATGGTTCTTCTTCATGTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002274.2-589s1c1
Sequence:CCGGGTCATCCTGGAGATTGACAATCTCGAGATTGTCAATCTCCAGGATGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002274.2-143s1c1
Sequence:CCGGGTGGTGTCTCTACCTGTTCAACTCGAGTTGAACAGGTAGAGACACCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002274.2-523s1c1
Sequence:CCGGCCCTACTACAAGACCATTGAACTCGAGTTCAATGGTCTTGTAGTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414223    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002274.3-1396s21c1
Sequence:CCGGTGATGTCCGTAGGCCTTAAATCTCGAGATTTAAGGCCTACGGACATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002274.3-941s21c1
Sequence:CCGGAGGAATGGTTCCACGCCAAGACTCGAGTCTTGGCGTGGAACCATTCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)