EMAIL THIS PAGE TO A FRIEND

KRT14

keratin 14

70 Gene Product Result for
Synonyms: CK14 EBS3 EBS4 K14 NFJ
Gene ID:
Human(3861) Summary: This gene encodes a member of the keratin family, the most diverse group of intermediate filaments. This gene product, a type I keratin, is usually found as a heterotetramer with two keratin 5 molecules, a type II keratin. Together they form the cytoskeleton of epithelial cells. Mutations in the genes for these keratins are associated with epidermolysis bullosa simplex. At least one pseudogene has been identified at 17p12-p11. [provided by RefSeq, Jul 2008]
Mouse(16664) keratin 14
Rat(287701) keratin 14
sheep(100303604) keratin 14
chicken(408039) keratin 14
cow(404111) keratin 14
dog(100685323) keratin 14
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000526 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000526 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000526 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016958 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016958 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016958 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU104641 MISSION® esiRNA esiRNA human KRT14 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000526 Rosetta Predictions human pricing
NM_001008751 Rosetta Predictions rat pricing
XM_579202 Rosetta Predictions rat pricing
NM_016958 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000526 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00198719 predicted 1399
2 SASI_Hs01_00198717 predicted 970
3 SASI_Hs01_00198716 predicted 960
4 SASI_Hs01_00198721 predicted 672
5 SASI_Hs01_00198724 predicted 608
6 SASI_Hs02_00302727 predicted 601
7 SASI_Hs02_00302728 predicted 1066
8 SASI_Hs02_00302729 predicted 1514
9 SASI_Hs02_00302730 predicted 1459
10 SASI_Hs02_00302731 predicted 1594
11 SASI_Hs01_00198718 predicted 1143
12 SASI_Hs01_00198720 predicted 921
13 SASI_Hs01_00198722 predicted 656
14 SASI_Hs01_00198723 predicted 851
15 SASI_Hs01_00198725 predicted 694
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008751 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00104187 predicted 732
2 SASI_Rn01_00104189 predicted 651
3 SASI_Rn01_00104191 predicted 1099
4 SASI_Rn01_00104192 predicted 633
5 SASI_Rn01_00104193 predicted 557
6 SASI_Rn01_00104194 predicted 646
7 SASI_Rn01_00104195 predicted 1105
8 SASI_Rn01_00104196 predicted 1026
9 SASI_Rn02_00199256 predicted 1286
10 SASI_Rn02_00199257 predicted 1280
11 SASI_Rn01_00104188 predicted 1073
12 SASI_Rn01_00104190 predicted 640
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579202 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00176101 predicted 737
2 SASI_Rn01_00176102 predicted 1072
3 SASI_Rn01_00176103 predicted 648
4 SASI_Rn01_00176104 predicted 634
5 SASI_Rn01_00176105 predicted 1103
6 SASI_Rn01_00176106 predicted 644
7 SASI_Rn01_00176107 predicted 555
8 SASI_Rn01_00176108 predicted 647
9 SASI_Rn01_00176109 predicted 1109
10 SASI_Rn01_00176110 predicted 1031
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016958 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00179066 predicted 1052
2 SASI_Mm01_00179067 predicted 1434
3 SASI_Mm01_00179068 predicted 1150
4 SASI_Mm01_00179069 predicted 1338
5 SASI_Mm01_00179070 predicted 1341
6 SASI_Mm01_00179071 predicted 827
7 SASI_Mm01_00179072 predicted 1386
8 SASI_Mm01_00179073 predicted 1424
9 SASI_Mm01_00179074 predicted 1156
10 SASI_Mm02_00323805 predicted 1171
11 SASI_Mm01_00179065 predicted 1349
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000526
KRT14 MISSION shRNA Bacterial Glycerol Stock
keratin 14
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000444936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000526.4-849s21c1
Sequence:CCGGAGGTGGGTGGAGATGTCAATGCTCGAGCATTGACATCTCCACCCACCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000526.4-1353s21c1
Sequence:CCGGTCTCCTCTGGATCGCAGTCATCTCGAGATGACTGCGATCCAGAGGAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000526.4-908s21c1
Sequence:CCGGATTCTGAACGAGATGCGTGACCTCGAGGTCACGCATCTCGTTCAGAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000526.3-1456s1c1
Sequence:CCGGGCAGGTCCTTCGCACCAAGAACTCGAGTTCTTGGTGCGAAGGACCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000526.3-967s1c1
Sequence:CCGGCGAGGAATGGTTCTTCACCAACTCGAGTTGGTGAAGAACCATTCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000526.3-547s1c1
Sequence:CCGGCAGTCCCTACTTCAAGACCATCTCGAGATGGTCTTGAAGTAGGGACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000526.3-676s1c1
Sequence:CCGGGACAGAGTTGAACCTGCGCATCTCGAGATGCGCAGGTTCAACTCTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000526.3-526s1c1
Sequence:CCGGGCCTGCTGAGATCAAAGACTACTCGAGTAGTCTTTGATCTCAGCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000526
KRT14 MISSION shRNA shRNA Plasmid DNA
keratin 14
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000444936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000526.4-849s21c1
Sequence:CCGGAGGTGGGTGGAGATGTCAATGCTCGAGCATTGACATCTCCACCCACCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000445011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000526.4-1353s21c1
Sequence:CCGGTCTCCTCTGGATCGCAGTCATCTCGAGATGACTGCGATCCAGAGGAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000526.4-908s21c1
Sequence:CCGGATTCTGAACGAGATGCGTGACCTCGAGGTCACGCATCTCGTTCAGAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000526.3-1456s1c1
Sequence:CCGGGCAGGTCCTTCGCACCAAGAACTCGAGTTCTTGGTGCGAAGGACCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000526.3-967s1c1
Sequence:CCGGCGAGGAATGGTTCTTCACCAACTCGAGTTGGTGAAGAACCATTCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000526.3-547s1c1
Sequence:CCGGCAGTCCCTACTTCAAGACCATCTCGAGATGGTCTTGAAGTAGGGACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000526.3-676s1c1
Sequence:CCGGGACAGAGTTGAACCTGCGCATCTCGAGATGCGCAGGTTCAACTCTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000526.3-526s1c1
Sequence:CCGGGCCTGCTGAGATCAAAGACTACTCGAGTAGTCTTTGATCTCAGCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000526
KRT14 MISSION shRNA Lentiviral Transduction Particles
keratin 14
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000444936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000526.4-849s21c1
Sequence:CCGGAGGTGGGTGGAGATGTCAATGCTCGAGCATTGACATCTCCACCCACCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000526.4-1353s21c1
Sequence:CCGGTCTCCTCTGGATCGCAGTCATCTCGAGATGACTGCGATCCAGAGGAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000526.4-908s21c1
Sequence:CCGGATTCTGAACGAGATGCGTGACCTCGAGGTCACGCATCTCGTTCAGAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000526.3-1456s1c1
Sequence:CCGGGCAGGTCCTTCGCACCAAGAACTCGAGTTCTTGGTGCGAAGGACCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000526.3-967s1c1
Sequence:CCGGCGAGGAATGGTTCTTCACCAACTCGAGTTGGTGAAGAACCATTCCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000526.3-547s1c1
Sequence:CCGGCAGTCCCTACTTCAAGACCATCTCGAGATGGTCTTGAAGTAGGGACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000526.3-676s1c1
Sequence:CCGGGACAGAGTTGAACCTGCGCATCTCGAGATGCGCAGGTTCAACTCTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000526.3-526s1c1
Sequence:CCGGGCCTGCTGAGATCAAAGACTACTCGAGTAGTCTTTGATCTCAGCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016958
KRT14 MISSION shRNA Bacterial Glycerol Stock
keratin 14
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000421797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016958.1-1490s21c1
Sequence:CCGGGTCCTGCGCACCAAGAACTAACTCGAGTTAGTTCTTGGTGCGCAGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016958.1-1396s21c1
Sequence:CCGGTCAGTCATCCAGAGATGTGACCTCGAGGTCACATCTCTGGATGACTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016958.1-496s21c1
Sequence:CCGGTGAACTGGAGGTGAAGATTCGCTCGAGCGAATCTTCACCTCCAGTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016958.1-627s21c1
Sequence:CCGGATGTCCTCCTGCAGATCGACACTCGAGTGTCGATCTGCAGGAGGACATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016958.1-1360s1c1
Sequence:CCGGCCAATTCTCCTCATCCTCTCACTCGAGTGAGAGGATGAGGAGAATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089748    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016958.1-1514s1c1
Sequence:CCGGTGCTACATGCTGCTCAGGCTTCTCGAGAAGCCTGAGCAGCATGTAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016958.1-1343s1c1
Sequence:CCGGGCCCACCTTTCATCTTCCCAACTCGAGTTGGGAAGATGAAAGGTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016958.1-538s1c1
Sequence:CCGGGCCCACTGAGATCAAAGACTACTCGAGTAGTCTTTGATCTCAGTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016958.1-832s1c1
Sequence:CCGGCGAGGAGGAAATGGCCTCCATCTCGAGATGGAGGCCATTTCCTCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016958
KRT14 MISSION shRNA shRNA Plasmid DNA
keratin 14
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000421797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016958.1-1490s21c1
Sequence:CCGGGTCCTGCGCACCAAGAACTAACTCGAGTTAGTTCTTGGTGCGCAGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016958.1-1396s21c1
Sequence:CCGGTCAGTCATCCAGAGATGTGACCTCGAGGTCACATCTCTGGATGACTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016958.1-496s21c1
Sequence:CCGGTGAACTGGAGGTGAAGATTCGCTCGAGCGAATCTTCACCTCCAGTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016958.1-627s21c1
Sequence:CCGGATGTCCTCCTGCAGATCGACACTCGAGTGTCGATCTGCAGGAGGACATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016958.1-1360s1c1
Sequence:CCGGCCAATTCTCCTCATCCTCTCACTCGAGTGAGAGGATGAGGAGAATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089748    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016958.1-1514s1c1
Sequence:CCGGTGCTACATGCTGCTCAGGCTTCTCGAGAAGCCTGAGCAGCATGTAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016958.1-1343s1c1
Sequence:CCGGGCCCACCTTTCATCTTCCCAACTCGAGTTGGGAAGATGAAAGGTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016958.1-538s1c1
Sequence:CCGGGCCCACTGAGATCAAAGACTACTCGAGTAGTCTTTGATCTCAGTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016958.1-832s1c1
Sequence:CCGGCGAGGAGGAAATGGCCTCCATCTCGAGATGGAGGCCATTTCCTCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016958
KRT14 MISSION shRNA Lentiviral Transduction Particles
keratin 14
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000421797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016958.1-1490s21c1
Sequence:CCGGGTCCTGCGCACCAAGAACTAACTCGAGTTAGTTCTTGGTGCGCAGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016958.1-1396s21c1
Sequence:CCGGTCAGTCATCCAGAGATGTGACCTCGAGGTCACATCTCTGGATGACTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016958.1-496s21c1
Sequence:CCGGTGAACTGGAGGTGAAGATTCGCTCGAGCGAATCTTCACCTCCAGTTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016958.1-627s21c1
Sequence:CCGGATGTCCTCCTGCAGATCGACACTCGAGTGTCGATCTGCAGGAGGACATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016958.1-1360s1c1
Sequence:CCGGCCAATTCTCCTCATCCTCTCACTCGAGTGAGAGGATGAGGAGAATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089748    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016958.1-1514s1c1
Sequence:CCGGTGCTACATGCTGCTCAGGCTTCTCGAGAAGCCTGAGCAGCATGTAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016958.1-1343s1c1
Sequence:CCGGGCCCACCTTTCATCTTCCCAACTCGAGTTGGGAAGATGAAAGGTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016958.1-538s1c1
Sequence:CCGGGCCCACTGAGATCAAAGACTACTCGAGTAGTCTTTGATCTCAGTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016958.1-832s1c1
Sequence:CCGGCGAGGAGGAAATGGCCTCCATCTCGAGATGGAGGCCATTTCCTCCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)