EMAIL THIS PAGE TO A FRIEND

KRT15

keratin 15

74 Gene Product Result for
Synonyms: CK15 K15 K1CO
UniProtKB ID: P19012, B3KQY1, Q53XV8, Q9BUG4
Gene ID:
Human(3866) Summary: The protein encoded by this gene is a member of the keratin gene family. The keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into cytokeratins and hair keratins. Most of the type I cytokeratins consist of acidic proteins which are arranged in pairs of heterotypic keratin chains and are clustered in a region on chromosome 17q21.2. [provided by RefSeq, Jul 2008]
Mouse(16665) keratin 15
Rat(287700) keratin 15
Zebrafish(406844) keratin 15
dog(100685404) keratin 15
cow(507464) keratin 15
chicken(408040) keratin 15
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4501658 Anti-Keratin 15 antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
SAB2701914 Anti-krt15 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
immunohistochemistry pricing
SAB2701931 Anti-krt15 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
immunohistochemistry pricing
AV00005 Anti-KRT15 antibody produced in rabbit affinity isolated antibody mouse, bovine, human
immunohistochemistry, western blot pricing
HPA023910 Anti-KRT15 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, Ab1 Antibody Enhanced Validation human
immunofluorescence, immunohistochemistry, western blot pricing
HPA024554 Anti-KRT15 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, Ab2 Antibody Enhanced Validation human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2101301 Anti-KRT15 antibody produced in rabbit affinity isolated antibody human, rat, bovine, mouse
western blot pricing
SAB1410742 Anti-KRT15 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB5300060 Monoclonal Anti-KRT15 antibody produced in mouse clone 6E7, ascites fluid human
ELISA, flow cytometry, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008469 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008469 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008469 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002275 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002275 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002275 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU029711 MISSION® esiRNA esiRNA human KRT15 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002275 Rosetta Predictions human pricing
NM_001004022 Rosetta Predictions rat pricing
XM_579118 Rosetta Predictions rat pricing
NM_008469 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002275 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00069432 predicted 1354
2 SASI_Hs02_00333555 predicted 1345
3 SASI_Hs01_00069434 predicted 1423
4 SASI_Hs02_00333556 predicted 1394
5 SASI_Hs01_00069437 predicted 1410
6 SASI_Hs01_00069439 predicted 980
7 SASI_Hs01_00069440 predicted 926
8 SASI_Hs01_00069441 predicted 1360
9 SASI_Hs02_00333557 predicted 1437
10 SASI_Hs02_00333558 predicted 1207
11 SASI_Hs01_00069433 predicted 869
12 SASI_Hs01_00069435 predicted 1411
13 SASI_Hs01_00069436 predicted 1017
14 SASI_Hs01_00069438 predicted 1232
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004022 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00089491 predicted 559
2 SASI_Rn01_00089492 predicted 1383
3 SASI_Rn01_00089493 predicted 1276
4 SASI_Rn01_00089494 predicted 1405
5 SASI_Rn01_00089495 predicted 560
6 SASI_Rn01_00089496 predicted 1244
7 SASI_Rn01_00089497 predicted 1378
8 SASI_Rn01_00089498 predicted 1343
9 SASI_Rn01_00089499 predicted 972
10 SASI_Rn01_00089500 predicted 491
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579118 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00127508 predicted 493
2 SASI_Rn01_00127509 predicted 889
3 SASI_Rn01_00127510 predicted 1104
4 SASI_Rn01_00127511 predicted 842
5 SASI_Rn01_00127512 predicted 704
6 SASI_Rn01_00127513 predicted 853
7 SASI_Rn01_00127514 predicted 899
8 SASI_Rn01_00127515 predicted 77
9 SASI_Rn01_00127516 predicted 1210
10 SASI_Rn01_00127517 predicted 490
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008469 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00101776 predicted 814
2 SASI_Mm01_00101778 predicted 897
3 SASI_Mm01_00101779 predicted 1073
4 SASI_Mm01_00101782 predicted 859
5 SASI_Mm01_00101783 predicted 975
6 SASI_Mm02_00313972 predicted 1122
7 SASI_Mm01_00101785 predicted 729
8 SASI_Mm02_00313973 predicted 866
9 SASI_Mm02_00313974 predicted 427
10 SASI_Mm02_00313975 predicted 1213
11 SASI_Mm01_00101777 predicted 551
12 SASI_Mm01_00101780 predicted 931
13 SASI_Mm01_00101781 predicted 931
14 SASI_Mm01_00101784 predicted 809
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008469
KRT15 MISSION shRNA Bacterial Glycerol Stock
keratin 15
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008469.1-429s1c1
Sequence:CCGGTCGGGACTACAGCCATTACTTCTCGAGAAGTAATGGCTGTAGTCCCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008469.1-116s1c1
Sequence:CCGGGAAGCCGAAGTATCTCTGCTTCTCGAGAAGCAGAGATACTTCGGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008469.1-1030s1c1
Sequence:CCGGGCAGAGGTGGAGTGCCGCTATCTCGAGATAGCGGCACTCCACCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008469.1-899s1c1
Sequence:CCGGAGGTGGCGTCTAACACAGAAACTCGAGTTTCTGTGTTAGACGCCACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008469.1-430s1c1
Sequence:CCGGCGGGACTACAGCCATTACTTTCTCGAGAAAGTAATGGCTGTAGTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008469
KRT15 MISSION shRNA shRNA Plasmid DNA
keratin 15
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008469.1-429s1c1
Sequence:CCGGTCGGGACTACAGCCATTACTTCTCGAGAAGTAATGGCTGTAGTCCCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008469.1-116s1c1
Sequence:CCGGGAAGCCGAAGTATCTCTGCTTCTCGAGAAGCAGAGATACTTCGGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008469.1-1030s1c1
Sequence:CCGGGCAGAGGTGGAGTGCCGCTATCTCGAGATAGCGGCACTCCACCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008469.1-899s1c1
Sequence:CCGGAGGTGGCGTCTAACACAGAAACTCGAGTTTCTGTGTTAGACGCCACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008469.1-430s1c1
Sequence:CCGGCGGGACTACAGCCATTACTTTCTCGAGAAAGTAATGGCTGTAGTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008469
KRT15 MISSION shRNA Lentiviral Transduction Particles
keratin 15
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008469.1-429s1c1
Sequence:CCGGTCGGGACTACAGCCATTACTTCTCGAGAAGTAATGGCTGTAGTCCCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008469.1-116s1c1
Sequence:CCGGGAAGCCGAAGTATCTCTGCTTCTCGAGAAGCAGAGATACTTCGGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008469.1-1030s1c1
Sequence:CCGGGCAGAGGTGGAGTGCCGCTATCTCGAGATAGCGGCACTCCACCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008469.1-899s1c1
Sequence:CCGGAGGTGGCGTCTAACACAGAAACTCGAGTTTCTGTGTTAGACGCCACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008469.1-430s1c1
Sequence:CCGGCGGGACTACAGCCATTACTTTCTCGAGAAAGTAATGGCTGTAGTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002275
KRT15 MISSION shRNA Bacterial Glycerol Stock
keratin 15
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116707    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002275.2-1527s1c1
Sequence:CCGGCCCTGCCTTCAGAGAGCTGAACTCGAGTTCAGCTCTCTGAAGGCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002275.2-180s1c1
Sequence:CCGGGAAGCCGAAGTATCTCAGCTTCTCGAGAAGCTGAGATACTTCGGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002275.2-1356s1c1
Sequence:CCGGGCAGCAGCAATTTCCACATCACTCGAGTGATGTGGAAATTGCTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002275.2-520s1c1
Sequence:CCGGCAGCCAATACTTCAAGACCATCTCGAGATGGTCTTGAAGTATTGGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002275.2-521s1c1
Sequence:CCGGAGCCAATACTTCAAGACCATTCTCGAGAATGGTCTTGAAGTATTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002275
KRT15 MISSION shRNA shRNA Plasmid DNA
keratin 15
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116707    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002275.2-1527s1c1
Sequence:CCGGCCCTGCCTTCAGAGAGCTGAACTCGAGTTCAGCTCTCTGAAGGCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002275.2-180s1c1
Sequence:CCGGGAAGCCGAAGTATCTCAGCTTCTCGAGAAGCTGAGATACTTCGGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002275.2-1356s1c1
Sequence:CCGGGCAGCAGCAATTTCCACATCACTCGAGTGATGTGGAAATTGCTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002275.2-520s1c1
Sequence:CCGGCAGCCAATACTTCAAGACCATCTCGAGATGGTCTTGAAGTATTGGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002275.2-521s1c1
Sequence:CCGGAGCCAATACTTCAAGACCATTCTCGAGAATGGTCTTGAAGTATTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002275
KRT15 MISSION shRNA Lentiviral Transduction Particles
keratin 15
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116707    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002275.2-1527s1c1
Sequence:CCGGCCCTGCCTTCAGAGAGCTGAACTCGAGTTCAGCTCTCTGAAGGCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002275.2-180s1c1
Sequence:CCGGGAAGCCGAAGTATCTCAGCTTCTCGAGAAGCTGAGATACTTCGGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002275.2-1356s1c1
Sequence:CCGGGCAGCAGCAATTTCCACATCACTCGAGTGATGTGGAAATTGCTGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002275.2-520s1c1
Sequence:CCGGCAGCCAATACTTCAAGACCATCTCGAGATGGTCTTGAAGTATTGGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002275.2-521s1c1
Sequence:CCGGAGCCAATACTTCAAGACCATTCTCGAGAATGGTCTTGAAGTATTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)