EMAIL THIS PAGE TO A FRIEND

KRT16

keratin 16

62 Gene Product Result for
Synonyms: CK16 FNEPPK K16 K1CP KRT16A NEPPK
UniProtKB ID: P08779, A8K488, P30654, Q16402, Q9UBG8
Gene ID:
Human(3868) Summary: The protein encoded by this gene is a member of the keratin gene family. The keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into cytokeratins and hair keratins. Most of the type I cytokeratins consist of acidic proteins which are arranged in pairs of heterotypic keratin chains and are clustered in a region of chromosome 17q12-q21. This keratin has been coexpressed with keratin 14 in a number of epithelial tissues, including esophagus, tongue, and hair follicles. Mutations in this gene are associated with type 1 pachyonychia congenita, non-epidermolytic palmoplantar keratoderma and unilateral palmoplantar verrucous nevus. [provided by RefSeq, Jul 2008]
Mouse(16666) keratin 16
Rat(303530) keratin 16
dog(490978) keratin 16
cow(100138169) keratin 16
sheep(101108147) keratin 16
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4501660 Anti-Keratin 16 antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB1105424 Anti-KRT16 (432-445) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB1105425 Anti-KRT16 (451-464) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB2103026 Anti-KRT16 antibody produced in rabbit affinity isolated antibody bovine, human, sheep, mouse, guinea pig, canine, horse, rat, rabbit, rabbit
western blot pricing
SAB2103027 Anti-KRT16 antibody produced in rabbit affinity isolated antibody rat, bovine, mouse, canine, rabbit, sheep, guinea pig, human, horse
western blot pricing
SAB1410744 Anti-KRT16 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human, mouse
western blot pricing
C2562 Monoclonal Anti-Cytokeratin, pan (Mixture) antibody produced in mouse clone C-11+PCK-26+CY-90+KS-1A3+M20+A53-B/A2, ascites fluid wide range
immunofluorescence, immunohistochemistry, western blot pricing
C9687 Monoclonal Anti-Cytokeratin, pan (Mixture) Prediluted antibody produced in mouse clone C-11+PCK-26+CY-90+KS-1A3+M20+A53-B/A2, ascites fluid wide range
immunohistochemistry pricing
C2931 Monoclonal Anti-Cytokeratin, pan antibody produced in mouse clone C-11, ascites fluid bovine, frog, rat, human, kangaroo rat, mouse
immunofluorescence, immunohistochemistry, western blot pricing
C1801 Monoclonal Anti-Cytokeratin, pan antibody produced in mouse ascites fluid, clone PCK-26 lizard, goat, bovine, human, hamster, rat, carp, guinea pig, pig, rabbit, sheep, mouse, chicken, snake, feline, canine
immunofluorescence, immunohistochemistry, western blot pricing
P2871 Monoclonal Anti-Cytokeratin, pan antibody produced in mouse clone C-11, purified immunoglobulin, buffered aqueous solution bovine, frog, rat, human, kangaroo rat, mouse
immunocytochemistry, immunohistochemistry, microarray, western blot pricing
C5992 Monoclonal Anti-Cytokeratin, pan antibody produced in mouse clone PCK-26, purified immunoglobulin, buffered aqueous solution lizard, goat, bovine, human, hamster, rat, carp, guinea pig, pig, rabbit, sheep, mouse, chicken, snake, feline, canine
dot blot, immunocytochemistry, immunohistochemistry, western blot pricing
F3418 Monoclonal Anti-Cytokeratin, pan−FITC antibody produced in mouse clone C-11, purified immunoglobulin, buffered aqueous solution bovine, frog, rat, human, kangaroo rat, mouse
immunofluorescence, immunohistochemistry, western blot pricing
F0397 Monoclonal Anti-Cytokeratin, pan−FITC antibody produced in mouse clone PCK-26, purified immunoglobulin, buffered aqueous solution lizard, goat, bovine, human, hamster, rat, carp, guinea pig, pig, rabbit, sheep, mouse, chicken, snake, feline, canine
immunofluorescence, immunohistochemistry pricing
SRE0061 Monoclonal Anti-pan-Cytokeratin clone PCK-26, Reagents designed and manufactured under cGMP controls suitable for use in an IVD application. lizard, goat, bovine, human, hamster, rat, carp, guinea pig, pig, rabbit, sheep, mouse, chicken, snake, feline, canine
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008470 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008470 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008470 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005557 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005557 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005557 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005557 Rosetta Predictions human pricing
NM_001008752 Rosetta Predictions rat pricing
XM_579203 Rosetta Predictions rat pricing
NM_008470 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005557 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00339811 predicted 740
2 SASI_Hs01_00168252 predicted 1090
3 SASI_Hs01_00168254 predicted 1093
4 SASI_Hs01_00168255 predicted 928
5 SASI_Hs02_00339812 predicted 1097
6 SASI_Hs01_00168256 predicted 1046
7 SASI_Hs01_00168257 predicted 1409
8 SASI_Hs01_00168258 predicted 1043
9 SASI_Hs01_00168259 predicted 1415
10 SASI_Hs02_00339813 predicted 748
11 SASI_Hs01_00168253 predicted 686
12 SASI_Hs01_00168260 predicted 724
13 SASI_Hs01_00168261 predicted 1170
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008752 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00072724 predicted 484
2 SASI_Rn01_00072725 predicted 582
3 SASI_Rn01_00072726 predicted 509
4 SASI_Rn01_00072727 predicted 497
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579203 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00132053 predicted 659
2 SASI_Rn01_00132054 predicted 594
3 SASI_Rn01_00132055 predicted 491
4 SASI_Rn01_00132056 predicted 573
5 SASI_Rn01_00132057 predicted 594
6 SASI_Rn01_00132058 predicted 690
7 SASI_Rn01_00132059 predicted 513
8 SASI_Rn01_00132060 predicted 575
9 SASI_Rn01_00132061 predicted 507
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008470 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00063055 predicted 1112
2 SASI_Mm01_00063056 predicted 1082
3 SASI_Mm01_00063059 predicted 624
4 SASI_Mm01_00063060 predicted 1205
5 SASI_Mm01_00063061 predicted 1010
6 SASI_Mm01_00063062 predicted 954
7 SASI_Mm01_00063063 predicted 867
8 SASI_Mm01_00063064 predicted 948
9 SASI_Mm02_00313976 predicted 755
10 SASI_Mm02_00313977 predicted 960
11 SASI_Mm01_00063057 predicted 1012
12 SASI_Mm01_00063058 predicted 713
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008470
KRT16 MISSION shRNA Bacterial Glycerol Stock
keratin 16
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008470.1-1191s1c1
Sequence:CCGGCCAGGAGTACAACATCTTGTTCTCGAGAACAAGATGTTGTACTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008470.1-966s1c1
Sequence:CCGGCAGTGATCTAATCCAGAGCAACTCGAGTTGCTCTGGATTAGATCACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008470.1-561s1c1
Sequence:CCGGGTTCACTTTGCAGATTGACAACTCGAGTTGTCAATCTGCAAAGTGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008470.1-1354s1c1
Sequence:CCGGCGGTCCATCCTCAAGGAGCAACTCGAGTTGCTCCTTGAGGATGGACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008470.1-848s1c1
Sequence:CCGGGCCGCATTCTGAATGAGATGACTCGAGTCATCTCATTCAGAATGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008470
KRT16 MISSION shRNA shRNA Plasmid DNA
keratin 16
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008470.1-1191s1c1
Sequence:CCGGCCAGGAGTACAACATCTTGTTCTCGAGAACAAGATGTTGTACTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008470.1-966s1c1
Sequence:CCGGCAGTGATCTAATCCAGAGCAACTCGAGTTGCTCTGGATTAGATCACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008470.1-561s1c1
Sequence:CCGGGTTCACTTTGCAGATTGACAACTCGAGTTGTCAATCTGCAAAGTGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008470.1-1354s1c1
Sequence:CCGGCGGTCCATCCTCAAGGAGCAACTCGAGTTGCTCCTTGAGGATGGACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008470.1-848s1c1
Sequence:CCGGGCCGCATTCTGAATGAGATGACTCGAGTCATCTCATTCAGAATGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008470
KRT16 MISSION shRNA Lentiviral Transduction Particles
keratin 16
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008470.1-1191s1c1
Sequence:CCGGCCAGGAGTACAACATCTTGTTCTCGAGAACAAGATGTTGTACTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008470.1-966s1c1
Sequence:CCGGCAGTGATCTAATCCAGAGCAACTCGAGTTGCTCTGGATTAGATCACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008470.1-561s1c1
Sequence:CCGGGTTCACTTTGCAGATTGACAACTCGAGTTGTCAATCTGCAAAGTGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008470.1-1354s1c1
Sequence:CCGGCGGTCCATCCTCAAGGAGCAACTCGAGTTGCTCCTTGAGGATGGACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008470.1-848s1c1
Sequence:CCGGGCCGCATTCTGAATGAGATGACTCGAGTCATCTCATTCAGAATGCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005557
KRT16 MISSION shRNA Bacterial Glycerol Stock
keratin 16
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000084004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005557.2-1037s1c1
Sequence:CCGGGCCTCCAACAGCGAACTGGTACTCGAGTACCAGTTCGCTGTTGGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005557.2-686s1c1
Sequence:CCGGAGGACCAAGTATGAGCACGAACTCGAGTTCGTGCTCATACTTGGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005557.2-1384s1c1
Sequence:CCGGCCAATCCTATTCTTCCCGCGACTCGAGTCGCGGGAAGAATAGGATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005557.2-880s1c1
Sequence:CCGGCGGAGATGTGAACGTGGAGATCTCGAGATCTCCACGTTCACATCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005557.2-226s1c1
Sequence:CCGGCCTGTCTGTCTCCTCTCGCTTCTCGAGAAGCGAGAGGAGACAGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005557.3-1071s21c1
Sequence:CCGGAGACCGAGGAGCTGAACAAAGCTCGAGCTTTGTTCAGCTCCTCGGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005557.3-495s21c1
Sequence:CCGGTGACCATGCAGAACCTCAATGCTCGAGCATTGAGGTTCTGCATGGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005557
KRT16 MISSION shRNA shRNA Plasmid DNA
keratin 16
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000084004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005557.2-1037s1c1
Sequence:CCGGGCCTCCAACAGCGAACTGGTACTCGAGTACCAGTTCGCTGTTGGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005557.2-686s1c1
Sequence:CCGGAGGACCAAGTATGAGCACGAACTCGAGTTCGTGCTCATACTTGGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005557.2-1384s1c1
Sequence:CCGGCCAATCCTATTCTTCCCGCGACTCGAGTCGCGGGAAGAATAGGATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005557.2-880s1c1
Sequence:CCGGCGGAGATGTGAACGTGGAGATCTCGAGATCTCCACGTTCACATCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005557.2-226s1c1
Sequence:CCGGCCTGTCTGTCTCCTCTCGCTTCTCGAGAAGCGAGAGGAGACAGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005557.3-1071s21c1
Sequence:CCGGAGACCGAGGAGCTGAACAAAGCTCGAGCTTTGTTCAGCTCCTCGGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005557.3-495s21c1
Sequence:CCGGTGACCATGCAGAACCTCAATGCTCGAGCATTGAGGTTCTGCATGGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005557
KRT16 MISSION shRNA Lentiviral Transduction Particles
keratin 16
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000084004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005557.2-1037s1c1
Sequence:CCGGGCCTCCAACAGCGAACTGGTACTCGAGTACCAGTTCGCTGTTGGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005557.2-686s1c1
Sequence:CCGGAGGACCAAGTATGAGCACGAACTCGAGTTCGTGCTCATACTTGGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005557.2-1384s1c1
Sequence:CCGGCCAATCCTATTCTTCCCGCGACTCGAGTCGCGGGAAGAATAGGATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005557.2-880s1c1
Sequence:CCGGCGGAGATGTGAACGTGGAGATCTCGAGATCTCCACGTTCACATCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005557.2-226s1c1
Sequence:CCGGCCTGTCTGTCTCCTCTCGCTTCTCGAGAAGCGAGAGGAGACAGACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005557.3-1071s21c1
Sequence:CCGGAGACCGAGGAGCTGAACAAAGCTCGAGCTTTGTTCAGCTCCTCGGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005557.3-495s21c1
Sequence:CCGGTGACCATGCAGAACCTCAATGCTCGAGCATTGAGGTTCTGCATGGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)