EMAIL THIS PAGE TO A FRIEND

KRT17

keratin 17

59 Gene Product Result for
Synonyms: K17 PC PC2 PCHC1
Gene ID:
Human(3872) Summary: This gene encodes the type I intermediate filament chain keratin 17, expressed in nail bed, hair follicle, sebaceous glands, and other epidermal appendages. Mutations in this gene lead to Jackson-Lawler type pachyonychia congenita and steatocystoma multiplex. [provided by RefSeq, Aug 2008]
Mouse(16667) keratin 17
Rat(287702) keratin 17
cow(281889) keratin 17
dog(490977) keratin 17
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA000452 Anti-JUP antibody produced in rabbit Ab1, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunofluorescence, immunohistochemistry, western blot pricing
HPA000453 Anti-JUP antibody produced in rabbit Ab2, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunohistochemistry, western blot pricing
SAB4501662 Anti-Keratin 17 antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB5500125 Anti-Keratin 17 antibody, Rabbit monoclonal clone SP95, recombinant, expressed in proprietary host, affinity isolated antibody human (tested)
flow cytometry, immunohistochemistry, western blot pricing
AV41733 Anti-KRT17 antibody produced in rabbit affinity isolated antibody rabbit, canine, human, sheep, mouse, horse, rat, bovine, zebrafish
immunohistochemistry, western blot pricing
HPA045062 Anti-KRT17 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunofluorescence, immunohistochemistry, western blot pricing
C9179 Monoclonal Anti-Cytokeratin Peptide 17 antibody produced in mouse clone CK-E3, ascites fluid human, bovine, goat, rat, pig
immunofluorescence, microarray, western blot pricing
WH0003872M1 Monoclonal Anti-KRT17 antibody produced in mouse clone 2D4-1G9, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB1400147 Monoclonal Anti-KRT17 antibody produced in mouse clone 2D10, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000422 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000422 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000422 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010663 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010663 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010663 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000422 Rosetta Predictions human pricing
NM_212545 Rosetta Predictions rat pricing
NM_010663 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000422 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00302523 predicted 438
2 SASI_Hs01_00053471 predicted 1224
3 SASI_Hs01_00053474 predicted 1455
4 SASI_Hs01_00053475 predicted 1457
5 SASI_Hs01_00053476 predicted 1459
6 SASI_Hs01_00053468 predicted 812
7 SASI_Hs01_00053469 predicted 1139
8 SASI_Hs01_00053470 predicted 542
9 SASI_Hs01_00053472 predicted 938
10 SASI_Hs01_00053473 predicted 1036
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212545 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00042867 predicted 512
2 SASI_Rn01_00042868 predicted 433
3 SASI_Rn02_00270569 predicted 458
4 SASI_Rn01_00042869 predicted 877
5 SASI_Rn01_00042871 predicted 446
6 SASI_Rn01_00042872 predicted 1233
7 SASI_Rn01_00042874 predicted 749
8 SASI_Rn01_00042875 predicted 1214
9 SASI_Rn02_00270570 predicted 506
10 SASI_Rn01_00042876 predicted 1037
11 SASI_Rn01_00042870 predicted 1035
12 SASI_Rn01_00042873 predicted 884
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010663 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00128786 predicted 456
2 SASI_Mm01_00128787 predicted 834
3 SASI_Mm01_00128788 predicted 410
4 SASI_Mm01_00128789 predicted 937
5 SASI_Mm01_00128791 predicted 684
6 SASI_Mm01_00128794 predicted 172
7 SASI_Mm02_00319080 predicted 173
8 SASI_Mm02_00319081 predicted 1441
9 SASI_Mm02_00319082 predicted 1449
10 SASI_Mm02_00319083 predicted 1474
11 SASI_Mm01_00128790 predicted 366
12 SASI_Mm01_00128792 predicted 845
13 SASI_Mm01_00128793 predicted 351
14 SASI_Mm01_00128795 predicted 1470
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000422
VALIDATED
KRT17 MISSION shRNA Bacterial Glycerol Stock
keratin 17
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000423259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000422.2-737s21c1
Sequence:CCGGATGCAGATTGAGAACCTCAAGCTCGAGCTTGAGGTTCTCAATCTGCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000422.2-516s21c1
Sequence:CCGGGCCAGTACTACAGGACAATTGCTCGAGCAATTGTCCTGTAGTACTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000422.2-1342s21c1
Sequence:CCGGGGTGCGTACCATTGTGGAAGACTCGAGTCTTCCACAATGGTACGCACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000422.1-1228s1c1
Sequence:CCGGCACCTGACTCAGTACAAGAAACTCGAGTTTCTTGTACTGAGTCAGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000422.1-816s1c1
Sequence:CCGGGCGTGACCAGTATGAGAAGATCTCGAGATCTTCTCATACTGGTCACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000422.1-1231s1c1
Sequence:CCGGCTGACTCAGTACAAGAAAGAACTCGAGTTCTTTCTTGTACTGAGTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000422.1-1227s1c1
Sequence:CCGGCCACCTGACTCAGTACAAGAACTCGAGTTCTTGTACTGAGTCAGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000422.1-505s1c1
Sequence:CCGGGCCAACATCCTGCTACAGATTCTCGAGAATCTGTAGCAGGATGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000422
VALIDATED
KRT17 MISSION shRNA shRNA Plasmid DNA
keratin 17
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000423259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000422.2-737s21c1
Sequence:CCGGATGCAGATTGAGAACCTCAAGCTCGAGCTTGAGGTTCTCAATCTGCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000422.2-516s21c1
Sequence:CCGGGCCAGTACTACAGGACAATTGCTCGAGCAATTGTCCTGTAGTACTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000422.2-1342s21c1
Sequence:CCGGGGTGCGTACCATTGTGGAAGACTCGAGTCTTCCACAATGGTACGCACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000422.1-1228s1c1
Sequence:CCGGCACCTGACTCAGTACAAGAAACTCGAGTTTCTTGTACTGAGTCAGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000422.1-816s1c1
Sequence:CCGGGCGTGACCAGTATGAGAAGATCTCGAGATCTTCTCATACTGGTCACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000422.1-1231s1c1
Sequence:CCGGCTGACTCAGTACAAGAAAGAACTCGAGTTCTTTCTTGTACTGAGTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000422.1-1227s1c1
Sequence:CCGGCCACCTGACTCAGTACAAGAACTCGAGTTCTTGTACTGAGTCAGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000422.1-505s1c1
Sequence:CCGGGCCAACATCCTGCTACAGATTCTCGAGAATCTGTAGCAGGATGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000422
VALIDATED
KRT17 MISSION shRNA Lentiviral Transduction Particles
keratin 17
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000423259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000422.2-737s21c1
Sequence:CCGGATGCAGATTGAGAACCTCAAGCTCGAGCTTGAGGTTCTCAATCTGCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000422.2-516s21c1
Sequence:CCGGGCCAGTACTACAGGACAATTGCTCGAGCAATTGTCCTGTAGTACTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000422.2-1342s21c1
Sequence:CCGGGGTGCGTACCATTGTGGAAGACTCGAGTCTTCCACAATGGTACGCACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000422.1-1228s1c1
Sequence:CCGGCACCTGACTCAGTACAAGAAACTCGAGTTTCTTGTACTGAGTCAGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000422.1-816s1c1
Sequence:CCGGGCGTGACCAGTATGAGAAGATCTCGAGATCTTCTCATACTGGTCACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000422.1-1231s1c1
Sequence:CCGGCTGACTCAGTACAAGAAAGAACTCGAGTTCTTTCTTGTACTGAGTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000422.1-1227s1c1
Sequence:CCGGCCACCTGACTCAGTACAAGAACTCGAGTTCTTGTACTGAGTCAGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000422.1-505s1c1
Sequence:CCGGGCCAACATCCTGCTACAGATTCTCGAGAATCTGTAGCAGGATGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010663
KRT17 MISSION shRNA Bacterial Glycerol Stock
keratin 17
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010663.1-727s1c1
Sequence:CCGGCGGCGAAATCAACGTGGAGATCTCGAGATCTCCACGTTGATTTCGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010663.1-408s1c1
Sequence:CCGGCCAGAGACTACAGCGCTTATTCTCGAGAATAAGCGCTGTAGTCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010663.1-838s1c1
Sequence:CCGGCGAAGACTGGTTCTTCAGCAACTCGAGTTGCTGAAGAACCAGTCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010663.1-223s1c1
Sequence:CCGGCAGTGGTTATGGAGGCAACTTCTCGAGAAGTTGCCTCCATAACCACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010663.1-418s1c1
Sequence:CCGGCAGCGCTTATTACCATACCATCTCGAGATGGTATGGTAATAAGCGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010663
KRT17 MISSION shRNA shRNA Plasmid DNA
keratin 17
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010663.1-727s1c1
Sequence:CCGGCGGCGAAATCAACGTGGAGATCTCGAGATCTCCACGTTGATTTCGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010663.1-408s1c1
Sequence:CCGGCCAGAGACTACAGCGCTTATTCTCGAGAATAAGCGCTGTAGTCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010663.1-838s1c1
Sequence:CCGGCGAAGACTGGTTCTTCAGCAACTCGAGTTGCTGAAGAACCAGTCTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010663.1-223s1c1
Sequence:CCGGCAGTGGTTATGGAGGCAACTTCTCGAGAAGTTGCCTCCATAACCACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010663.1-418s1c1
Sequence:CCGGCAGCGCTTATTACCATACCATCTCGAGATGGTATGGTAATAAGCGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010663
KRT17 MISSION shRNA Lentiviral Transduction Particles
keratin 17
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010663.1-727s1c1
Sequence:CCGGCGGCGAAATCAACGTGGAGATCTCGAGATCTCCACGTTGATTTCGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010663.1-408s1c1
Sequence:CCGGCCAGAGACTACAGCGCTTATTCTCGAGAATAAGCGCTGTAGTCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010663.1-838s1c1
Sequence:CCGGCGAAGACTGGTTCTTCAGCAACTCGAGTTGCTGAAGAACCAGTCTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010663.1-223s1c1
Sequence:CCGGCAGTGGTTATGGAGGCAACTTCTCGAGAAGTTGCCTCCATAACCACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010663.1-418s1c1
Sequence:CCGGCAGCGCTTATTACCATACCATCTCGAGATGGTATGGTAATAAGCGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)