EMAIL THIS PAGE TO A FRIEND

KRT18

keratin 18

127 Gene Product Result for
Synonyms: CYK18 K18
UniProtKB ID: P05783, Q53G38, Q5U0N8, Q9BW26
Gene ID:
Human(3875) Summary: KRT18 encodes the type I intermediate filament chain keratin 18. Keratin 18, together with its filament partner keratin 8, are perhaps the most commonly found members of the intermediate filament gene family. They are expressed in single layer epithelial tissues of the body. Mutations in this gene have been linked to cryptogenic cirrhosis. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(16668) keratin 18
Rat(294853) keratin 18
Zebrafish(352912) keratin 18
cow(506480) keratin 18
dog(477601) keratin 18
sheep(101108117) keratin 18
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1306573 ANTI-CYK18(C-TERMINAL) antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
flow cytometry, immunofluorescence, immunohistochemistry, western blot pricing
SAB1306569 ANTI-CYK18(C-TERMINAL) antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human, mouse
flow cytometry, immunofluorescence, immunohistochemistry, western blot pricing
SAB4501663 Anti-Keratin 18 antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4501664 Anti-Keratin 18 antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing
SAB4501665 Anti-Keratin 18 antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB5500126 Anti-Keratin 18 antibody, Rabbit monoclonal clone SP69, recombinant, expressed in proprietary host, affinity isolated antibody human (tested)
flow cytometry, immunohistochemistry, western blot pricing
SAB4300551 Anti-KRT18 (Ab-33) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry pricing
AV40205 Anti-KRT18 (AB1) antibody produced in rabbit IgG fraction of antiserum horse, human
immunohistochemistry, western blot pricing
AV40206 Anti-KRT18 (AB2) antibody produced in rabbit IgG fraction of antiserum guinea pig, rat, human
immunohistochemistry, western blot pricing
GW22753 Anti-KRT18 antibody produced in chicken affinity isolated antibody, buffered aqueous solution rat, mouse, human
western blot pricing
SAB2701928 Anti-krt18 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
immunohistochemistry pricing
SAB4503767 Anti-phospho-Keratin 18 (pSer33) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4504156 Anti-phospho-Keratin 18 (pSer52) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunofluorescence, western blot pricing
SAB4300239 Anti-phospho-KRT18 (pSer33) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
SAB3300015 Monoclonal Anti-CK18 antibody produced in mouse clone 10, purified immunoglobulin, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB3300017 Monoclonal Anti-CK18 antibody produced in mouse clone 1H10, purified immunoglobulin, buffered aqueous glycerol solution human
western blot pricing
SAB1305526 MONOCLONAL ANTI-CYK18 (C-TERMINAL) antibody produced in mouse clone 695CT17.2.6, crude ascites, buffered aqueous solution human
western blot pricing
SAB1305562 MONOCLONAL ANTI-CYK18(C-TERMINAL) antibody produced in mouse clone 695CT17.2.6, IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
C7785 Monoclonal Anti-Cytokeratin 18 antibody produced in mouse clone CK5, ascites fluid human
immunofluorescence, microarray pricing
C8541 Monoclonal Anti-Cytokeratin Peptide 18 antibody produced in mouse clone CY-90, ascites fluid wide range
immunofluorescence, western blot pricing
C1399 Monoclonal Anti-Cytokeratin Peptide 18 antibody produced in mouse clone KS-B17.2, ascites fluid human
immunofluorescence, immunohistochemistry, microarray pricing
F4772 Monoclonal Anti-Cytokeratin Peptide 18−FITC antibody produced in mouse clone CY-90, purified immunoglobulin, buffered aqueous solution wide range
immunofluorescence, immunohistochemistry pricing
C2562 Monoclonal Anti-Cytokeratin, pan (Mixture) antibody produced in mouse clone C-11+PCK-26+CY-90+KS-1A3+M20+A53-B/A2, ascites fluid wide range
immunofluorescence, immunohistochemistry, western blot pricing
C9687 Monoclonal Anti-Cytokeratin, pan (Mixture) Prediluted antibody produced in mouse clone C-11+PCK-26+CY-90+KS-1A3+M20+A53-B/A2, ascites fluid wide range
immunohistochemistry pricing
C2931 Monoclonal Anti-Cytokeratin, pan antibody produced in mouse clone C-11, ascites fluid bovine, frog, rat, human, kangaroo rat, mouse
immunofluorescence, immunohistochemistry, western blot pricing
P2871 Monoclonal Anti-Cytokeratin, pan antibody produced in mouse clone C-11, purified immunoglobulin, buffered aqueous solution bovine, frog, rat, human, kangaroo rat, mouse
immunocytochemistry, immunohistochemistry, microarray, western blot pricing
F3418 Monoclonal Anti-Cytokeratin, pan−FITC antibody produced in mouse clone C-11, purified immunoglobulin, buffered aqueous solution bovine, frog, rat, human, kangaroo rat, mouse
immunofluorescence, immunohistochemistry, western blot pricing
WH0003875M1 Monoclonal Anti-KRT18 antibody produced in mouse clone 2F8, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB1404012 Monoclonal Anti-KRT18 antibody produced in mouse clone 1G8, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB4700411 Monoclonal Anti-KRT18 antibody produced in mouse clone C-04, purified immunoglobulin, buffered aqueous solution mammals
western blot pricing
SAB4700670 Monoclonal Anti-KRT18 antibody produced in mouse clone DC-10, purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB4700412 Monoclonal Anti-KRT18-Biotin antibody produced in mouse clone C-04, purified immunoglobulin, buffered aqueous solution mammals
flow cytometry pricing
SAB4700671 Monoclonal Anti-KRT18-Biotin antibody produced in mouse clone DC-10, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700413 Monoclonal Anti-KRT18-FITC antibody produced in mouse clone C-04, purified immunoglobulin, buffered aqueous solution mammals
flow cytometry pricing
SAB4700672 Monoclonal Anti-KRT18-FITC antibody produced in mouse clone DC-10, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000224 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000224 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000224 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010664 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010664 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010664 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000224 Rosetta Predictions human pricing
NM_199187 Rosetta Predictions human pricing
NM_053976 Rosetta Predictions rat pricing
XM_001053042 Rosetta Predictions rat pricing
NM_010664 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000224 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00302122 predicted 335
2 SASI_Hs02_00302123 predicted 355
3 SASI_Hs02_00302124 predicted 1006
4 SASI_Hs01_00145009 predicted 905
5 SASI_Hs02_00302125 predicted 912
6 SASI_Hs01_00145013 predicted 985
7 SASI_Hs01_00145014 predicted 835
8 SASI_Hs01_00145015 predicted 938
9 SASI_Hs02_00302126 predicted 638
10 SASI_Hs02_00302127 predicted 1027
11 SASI_Hs01_00145010 predicted 421
12 SASI_Hs01_00145011 predicted 1000
13 SASI_Hs01_00145012 predicted 861
14 SASI_Hs01_00145016 predicted 1131
15 SASI_Hs01_00145017 predicted 1108
16 SASI_Hs01_00145018 predicted 1268
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199187 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00372641 predicted 292
2 SASI_Hs02_00372642 predicted 308
3 SASI_Hs02_00372643 predicted 961
4 SASI_Hs01_00224523 predicted 855
5 SASI_Hs02_00372644 predicted 873
6 SASI_Hs01_00224527 predicted 936
7 SASI_Hs01_00224528 predicted 787
8 SASI_Hs01_00224529 predicted 895
9 SASI_Hs02_00372645 predicted 589
10 SASI_Hs02_00372646 predicted 977
11 SASI_Hs01_00224524 predicted 380
12 SASI_Hs01_00224525 predicted 959
13 SASI_Hs01_00224526 predicted 814
14 SASI_Hs01_00224530 predicted 1092
15 SASI_Hs01_00224531 predicted 1062
16 SASI_Hs01_00224532 predicted 1224
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053976 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00100896 predicted 717
2 SASI_Rn01_00100897 predicted 1104
3 SASI_Rn01_00100898 predicted 540
4 SASI_Rn02_00266961 predicted 626
5 SASI_Rn01_00100900 predicted 846
6 SASI_Rn01_00100901 predicted 426
7 SASI_Rn02_00266962 predicted 1007
8 SASI_Rn01_00100902 predicted 1060
9 SASI_Rn01_00100904 predicted 1096
10 SASI_Rn02_00266963 predicted 495
11 SASI_Rn01_00100899 predicted 999
12 SASI_Rn01_00100903 predicted 491
13 SASI_Rn01_00100905 predicted 259
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053042 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00271110 predicted 720
2 SASI_Rn02_00271111 predicted 1110
3 SASI_Rn02_00271112 predicted 543
4 SASI_Rn02_00271113 predicted 629
5 SASI_Rn02_00271114 predicted 839
6 SASI_Rn02_00271115 predicted 427
7 SASI_Rn02_00271116 predicted 1011
8 SASI_Rn02_00271117 predicted 1063
9 SASI_Rn02_00271118 predicted 1098
10 SASI_Rn02_00271119 predicted 495
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010664 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00041658 predicted 855
2 SASI_Mm01_00041654 predicted 947
3 SASI_Mm02_00319084 predicted 880
4 SASI_Mm01_00041655 predicted 1022
5 SASI_Mm01_00041656 predicted 1026
6 SASI_Mm02_00319085 predicted 833
7 SASI_Mm02_00319086 predicted 1063
8 SASI_Mm01_00041657 predicted 711
9 SASI_Mm01_00041659 predicted 1126
10 SASI_Mm01_00041660 predicted 652
11 SASI_Mm01_00041661 predicted 477
12 SASI_Mm01_00041662 predicted 1120
13 SASI_Mm01_00041663 predicted 275
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000224
VALIDATED
KRT18 MISSION shRNA Bacterial Glycerol Stock
keratin 18
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000299480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000224.2-748s21c1
Sequence:CCGGCTTCATGAAGAAGAACCACGACTCGAGTCGTGGTTCTTCTTCATGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000224.2-1210s1c1
Sequence:CCGGCCTGCTGAACATCAAGGTCAACTCGAGTTGACCTTGATGTTCAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_000224.2-572s1c1
Sequence:CCGGCAGATTGACAATGCCCGTCTTCTCGAGAAGACGGGCATTGTCAATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_000224.2-1277s1c1
Sequence:CCGGGAGGACTTTAATCTTGGTGATCTCGAGATCACCAAGATTAAAGTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_000224.2-748s1c1
Sequence:CCGGCTTCATGAAGAAGAACCACGACTCGAGTCGTGGTTCTTCTTCATGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_000224.2-683s1c1
Sequence:CCGGGATGACACCAATATCACACGACTCGAGTCGTGTGATATTGGTGTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000224.2-683s21c1
Sequence:CCGGGATGACACCAATATCACACGACTCGAGTCGTGTGATATTGGTGTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000224.2-572s21c1
Sequence:CCGGCAGATTGACAATGCCCGTCTTCTCGAGAAGACGGGCATTGTCAATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000224.2-1210s21c1
Sequence:CCGGCCTGCTGAACATCAAGGTCAACTCGAGTTGACCTTGATGTTCAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000224
VALIDATED
KRT18 MISSION shRNA shRNA Plasmid DNA
keratin 18
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000299480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000224.2-748s21c1
Sequence:CCGGCTTCATGAAGAAGAACCACGACTCGAGTCGTGGTTCTTCTTCATGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000224.2-1210s1c1
Sequence:CCGGCCTGCTGAACATCAAGGTCAACTCGAGTTGACCTTGATGTTCAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_000224.2-572s1c1
Sequence:CCGGCAGATTGACAATGCCCGTCTTCTCGAGAAGACGGGCATTGTCAATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_000224.2-1277s1c1
Sequence:CCGGGAGGACTTTAATCTTGGTGATCTCGAGATCACCAAGATTAAAGTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_000224.2-748s1c1
Sequence:CCGGCTTCATGAAGAAGAACCACGACTCGAGTCGTGGTTCTTCTTCATGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_000224.2-683s1c1
Sequence:CCGGGATGACACCAATATCACACGACTCGAGTCGTGTGATATTGGTGTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000224.2-683s21c1
Sequence:CCGGGATGACACCAATATCACACGACTCGAGTCGTGTGATATTGGTGTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000224.2-572s21c1
Sequence:CCGGCAGATTGACAATGCCCGTCTTCTCGAGAAGACGGGCATTGTCAATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000224.2-1210s21c1
Sequence:CCGGCCTGCTGAACATCAAGGTCAACTCGAGTTGACCTTGATGTTCAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000224
VALIDATED
KRT18 MISSION shRNA Lentiviral Transduction Particles
keratin 18
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000299480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000224.2-748s21c1
Sequence:CCGGCTTCATGAAGAAGAACCACGACTCGAGTCGTGGTTCTTCTTCATGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000224.2-1210s1c1
Sequence:CCGGCCTGCTGAACATCAAGGTCAACTCGAGTTGACCTTGATGTTCAGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_000224.2-572s1c1
Sequence:CCGGCAGATTGACAATGCCCGTCTTCTCGAGAAGACGGGCATTGTCAATCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_000224.2-1277s1c1
Sequence:CCGGGAGGACTTTAATCTTGGTGATCTCGAGATCACCAAGATTAAAGTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_000224.2-748s1c1
Sequence:CCGGCTTCATGAAGAAGAACCACGACTCGAGTCGTGGTTCTTCTTCATGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_000224.2-683s1c1
Sequence:CCGGGATGACACCAATATCACACGACTCGAGTCGTGTGATATTGGTGTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000224.2-683s21c1
Sequence:CCGGGATGACACCAATATCACACGACTCGAGTCGTGTGATATTGGTGTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000224.2-572s21c1
Sequence:CCGGCAGATTGACAATGCCCGTCTTCTCGAGAAGACGGGCATTGTCAATCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000224.2-1210s21c1
Sequence:CCGGCCTGCTGAACATCAAGGTCAACTCGAGTTGACCTTGATGTTCAGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010664
VALIDATED
KRT18 MISSION shRNA Bacterial Glycerol Stock
keratin 18
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000298435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010664.1-1030s21c1
Sequence:CCGGGCACAGATGGAGCAGCTCAATCTCGAGATTGAGCTGCTCCATCTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010664.1-513s21c1
Sequence:CCGGCGCCGATGACTTTAGAGTCAACTCGAGTTGACTCTAAAGTCATCGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010664.1-942s1c1
Sequence:CCGGCCAGACCTTGGAGATTGACTTCTCGAGAAGTCAATCTCCAAGGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010664.1-1233s1c1
Sequence:CCGGCTCCATGCAAACTGTGCAGAACTCGAGTTCTGCACAGTTTGCATGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010664.1-513s1c1
Sequence:CCGGCGCCGATGACTTTAGAGTCAACTCGAGTTGACTCTAAAGTCATCGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010664.1-453s1c1
Sequence:CCGGCCTTGCGAATTCTGTGGACAACTCGAGTTGTCCACAGAATTCGCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010664.1-1030s1c1
Sequence:CCGGGCACAGATGGAGCAGCTCAATCTCGAGATTGAGCTGCTCCATCTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010664.1-839s21c1
Sequence:CCGGAGTACTGGTCTCAGCAGATTGCTCGAGCAATCTGCTGAGACCAGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010664.1-880s21c1
Sequence:CCGGACCACCAAGTCTGCCGAAATCCTCGAGGATTTCGGCAGACTTGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010664.1-1233s21c1
Sequence:CCGGCTCCATGCAAACTGTGCAGAACTCGAGTTCTGCACAGTTTGCATGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010664
VALIDATED
KRT18 MISSION shRNA shRNA Plasmid DNA
keratin 18
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000298435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010664.1-1030s21c1
Sequence:CCGGGCACAGATGGAGCAGCTCAATCTCGAGATTGAGCTGCTCCATCTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010664.1-513s21c1
Sequence:CCGGCGCCGATGACTTTAGAGTCAACTCGAGTTGACTCTAAAGTCATCGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010664.1-942s1c1
Sequence:CCGGCCAGACCTTGGAGATTGACTTCTCGAGAAGTCAATCTCCAAGGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010664.1-1233s1c1
Sequence:CCGGCTCCATGCAAACTGTGCAGAACTCGAGTTCTGCACAGTTTGCATGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010664.1-513s1c1
Sequence:CCGGCGCCGATGACTTTAGAGTCAACTCGAGTTGACTCTAAAGTCATCGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010664.1-453s1c1
Sequence:CCGGCCTTGCGAATTCTGTGGACAACTCGAGTTGTCCACAGAATTCGCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010664.1-1030s1c1
Sequence:CCGGGCACAGATGGAGCAGCTCAATCTCGAGATTGAGCTGCTCCATCTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010664.1-839s21c1
Sequence:CCGGAGTACTGGTCTCAGCAGATTGCTCGAGCAATCTGCTGAGACCAGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010664.1-880s21c1
Sequence:CCGGACCACCAAGTCTGCCGAAATCCTCGAGGATTTCGGCAGACTTGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010664.1-1233s21c1
Sequence:CCGGCTCCATGCAAACTGTGCAGAACTCGAGTTCTGCACAGTTTGCATGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010664
VALIDATED
KRT18 MISSION shRNA Lentiviral Transduction Particles
keratin 18
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000298435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010664.1-1030s21c1
Sequence:CCGGGCACAGATGGAGCAGCTCAATCTCGAGATTGAGCTGCTCCATCTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010664.1-513s21c1
Sequence:CCGGCGCCGATGACTTTAGAGTCAACTCGAGTTGACTCTAAAGTCATCGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010664.1-942s1c1
Sequence:CCGGCCAGACCTTGGAGATTGACTTCTCGAGAAGTCAATCTCCAAGGTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010664.1-1233s1c1
Sequence:CCGGCTCCATGCAAACTGTGCAGAACTCGAGTTCTGCACAGTTTGCATGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010664.1-513s1c1
Sequence:CCGGCGCCGATGACTTTAGAGTCAACTCGAGTTGACTCTAAAGTCATCGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010664.1-453s1c1
Sequence:CCGGCCTTGCGAATTCTGTGGACAACTCGAGTTGTCCACAGAATTCGCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010664.1-1030s1c1
Sequence:CCGGGCACAGATGGAGCAGCTCAATCTCGAGATTGAGCTGCTCCATCTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010664.1-839s21c1
Sequence:CCGGAGTACTGGTCTCAGCAGATTGCTCGAGCAATCTGCTGAGACCAGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010664.1-880s21c1
Sequence:CCGGACCACCAAGTCTGCCGAAATCCTCGAGGATTTCGGCAGACTTGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010664.1-1233s21c1
Sequence:CCGGCTCCATGCAAACTGTGCAGAACTCGAGTTCTGCACAGTTTGCATGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)