EMAIL THIS PAGE TO A FRIEND

KRT18P55

keratin 18 pseudogene 55

52 Gene Product Result for
Species: Human KRT18P55(284085)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173624 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173624 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173624 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173624 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173624 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00158281 predicted 678
2 SASI_Hs02_00368502 predicted 127
3 SASI_Hs01_00158277 predicted 108
4 SASI_Hs01_00158276 predicted 1425
5 SASI_Hs01_00158278 predicted 1348
6 SASI_Hs01_00158279 predicted 1572
7 SASI_Hs01_00158280 predicted 515
8 SASI_Hs01_00158282 predicted 1033
9 SASI_Hs01_00158283 predicted 1754
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173624
KRT18P55 MISSION shRNA Bacterial Glycerol Stock
keratin 18 pseudogene 55
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000117188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173624.1-520s1c1
Sequence:CCGGAGTTAGATTTACCTTCAGCTTCTCGAGAAGCTGAAGGTAAATCTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173624.1-898s1c1
Sequence:CCGGGCCTGGATACCAAGAACTGGACTCGAGTCCAGTTCTTGGTATCCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117187    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173624.1-1741s1c1
Sequence:CCGGGCTGGAAGACAGTGAGGACTTCTCGAGAAGTCCTCACTGTCTTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173624.1-1023s1c1
Sequence:CCGGACTGTGGACAGTGCCCACATTCTCGAGAATGTGGGCACTGTCCACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173624.1-697s1c1
Sequence:CCGGCCAGTGTCTATGCAGGCATCACTCGAGTGATGCCTGCATAGACACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173624
KRT18P55 MISSION shRNA shRNA Plasmid DNA
keratin 18 pseudogene 55
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000117188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173624.1-520s1c1
Sequence:CCGGAGTTAGATTTACCTTCAGCTTCTCGAGAAGCTGAAGGTAAATCTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173624.1-898s1c1
Sequence:CCGGGCCTGGATACCAAGAACTGGACTCGAGTCCAGTTCTTGGTATCCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117187    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173624.1-1741s1c1
Sequence:CCGGGCTGGAAGACAGTGAGGACTTCTCGAGAAGTCCTCACTGTCTTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173624.1-1023s1c1
Sequence:CCGGACTGTGGACAGTGCCCACATTCTCGAGAATGTGGGCACTGTCCACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173624.1-697s1c1
Sequence:CCGGCCAGTGTCTATGCAGGCATCACTCGAGTGATGCCTGCATAGACACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173624
KRT18P55 MISSION shRNA Lentiviral Transduction Particles
keratin 18 pseudogene 55
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000117188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173624.1-520s1c1
Sequence:CCGGAGTTAGATTTACCTTCAGCTTCTCGAGAAGCTGAAGGTAAATCTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173624.1-898s1c1
Sequence:CCGGGCCTGGATACCAAGAACTGGACTCGAGTCCAGTTCTTGGTATCCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117187    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173624.1-1741s1c1
Sequence:CCGGGCTGGAAGACAGTGAGGACTTCTCGAGAAGTCCTCACTGTCTTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173624.1-1023s1c1
Sequence:CCGGACTGTGGACAGTGCCCACATTCTCGAGAATGTGGGCACTGTCCACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173624.1-697s1c1
Sequence:CCGGCCAGTGTCTATGCAGGCATCACTCGAGTGATGCCTGCATAGACACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)