EMAIL THIS PAGE TO A FRIEND

KRT19

keratin 19

59 Gene Product Result for
Synonyms: CK19 K19 K1CS
Gene ID:
Human(3880) Summary: The protein encoded by this gene is a member of the keratin family. The keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into cytokeratins and hair keratins. The type I cytokeratins consist of acidic proteins which are arranged in pairs of heterotypic keratin chains. Unlike its related family members, this smallest known acidic cytokeratin is not paired with a basic cytokeratin in epithelial cells. It is specifically expressed in the periderm, the transiently superficial layer that envelopes the developing epidermis. The type I cytokeratins are clustered in a region of chromosome 17q12-q21. [provided by RefSeq, Jul 2008]
Mouse(16669) keratin 19
Rat(360626) keratin 19
chicken(395861) keratin 19
cow(281470) keratin 19
cow(514812) keratin 19
dog(100685481) keratin 19
sheep(101117946) keratin 19
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4501670 Anti-Keratin 19 antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
SAB2101302 Anti-KRT19 (ab1) antibody produced in rabbit affinity isolated antibody rat, human, dog, horse, pig, bovine, mouse, rabbit
immunohistochemistry, western blot pricing
SAB2101303 Anti-KRT19 (ab2) antibody produced in rabbit affinity isolated antibody human, rabbit
western blot pricing
SAB1400148 Anti-KRT19 antibody produced in mouse IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing
HPA002465 Anti-KRT19 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunofluorescence, immunohistochemistry pricing
SAB3300019 Monoclonal Anti-CK19 antibody produced in mouse clone 2F8, purified immunoglobulin, buffered aqueous glycerol solution human
immunofluorescence, western blot pricing
SAB4700775 Monoclonal Anti-Cytokeratin 19 antibody produced in mouse clone A53-B/A2, purified immunoglobulin, buffered aqueous solution human
ELISA, flow cytometry, immunocytochemistry, immunohistochemistry, immunoprecipitation (IP), western blot pricing
C7159 Monoclonal Anti-Cytokeratin 4.62 antibody produced in mouse clone K4.62, ascites fluid human
immunofluorescence pricing
C6930 Monoclonal Anti-Cytokeratin Peptide 19 antibody produced in mouse clone A53-B/A2, tissue culture supernatant human
immunofluorescence, microarray pricing
C2562 Monoclonal Anti-Cytokeratin, pan (Mixture) antibody produced in mouse clone C-11+PCK-26+CY-90+KS-1A3+M20+A53-B/A2, ascites fluid wide range
immunofluorescence, immunohistochemistry, western blot pricing
C9687 Monoclonal Anti-Cytokeratin, pan (Mixture) Prediluted antibody produced in mouse clone C-11+PCK-26+CY-90+KS-1A3+M20+A53-B/A2, ascites fluid wide range
immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008471 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008471 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008471 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002276 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002276 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002276 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002276 Rosetta Predictions human pricing
NM_199498 Rosetta Predictions rat pricing
NM_008471 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002276 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00195383 predicted 883
2 SASI_Hs01_00195384 predicted 791
3 SASI_Hs01_00195385 predicted 792
4 SASI_Hs01_00195386 predicted 227
5 SASI_Hs01_00195387 predicted 1082
6 SASI_Hs01_00195388 predicted 1082
7 SASI_Hs01_00195389 predicted 1157
8 SASI_Hs01_00195390 predicted 1145
9 SASI_Hs01_00195391 predicted 225
10 SASI_Hs01_00195392 predicted 1185
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199498 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00093929 predicted 442
2 SASI_Rn01_00093930 predicted 920
3 SASI_Rn01_00093931 predicted 926
4 SASI_Rn01_00093932 predicted 863
5 SASI_Rn01_00093933 predicted 506
6 SASI_Rn01_00093934 predicted 497
7 SASI_Rn01_00093935 predicted 874
8 SASI_Rn01_00093936 predicted 876
9 SASI_Rn01_00093937 predicted 1088
10 SASI_Rn01_00093938 predicted 1017
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008471 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00183726 predicted 594
2 SASI_Mm01_00183727 predicted 867
3 SASI_Mm01_00183728 predicted 377
4 SASI_Mm01_00183729 predicted 283
5 SASI_Mm01_00183731 predicted 327
6 SASI_Mm01_00183733 predicted 465
7 SASI_Mm02_00313978 predicted 481
8 SASI_Mm01_00183734 predicted 1051
9 SASI_Mm01_00183735 predicted 837
10 SASI_Mm02_00313979 predicted 714
11 SASI_Mm01_00183730 predicted 810
12 SASI_Mm01_00183732 predicted 985
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008471
KRT19 MISSION shRNA Bacterial Glycerol Stock
keratin 19
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008471.2-514s1c1
Sequence:CCGGTCCAAGATTGTCCTACAGATTCTCGAGAATCTGTAGGACAATCTTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090553    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008471.2-1335s1c1
Sequence:CCGGCTCCCTCGACTTGTCAATAAACTCGAGTTTATTGACAAGTCGAGGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008471.2-1140s1c1
Sequence:CCGGGCGCCAGAACCAGGAGTATAACTCGAGTTATACTCCTGGTTCTGGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008471.2-874s1c1
Sequence:CCGGGCCACCTACCTTGCTCGGATTCTCGAGAATCCGAGCAAGGTAGGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008471.2-442s1c1
Sequence:CCGGCGAGATTACAACCACTACTTTCTCGAGAAAGTAGTGGTTGTAATCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008471
KRT19 MISSION shRNA shRNA Plasmid DNA
keratin 19
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008471.2-514s1c1
Sequence:CCGGTCCAAGATTGTCCTACAGATTCTCGAGAATCTGTAGGACAATCTTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090553    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008471.2-1335s1c1
Sequence:CCGGCTCCCTCGACTTGTCAATAAACTCGAGTTTATTGACAAGTCGAGGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008471.2-1140s1c1
Sequence:CCGGGCGCCAGAACCAGGAGTATAACTCGAGTTATACTCCTGGTTCTGGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008471.2-874s1c1
Sequence:CCGGGCCACCTACCTTGCTCGGATTCTCGAGAATCCGAGCAAGGTAGGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008471.2-442s1c1
Sequence:CCGGCGAGATTACAACCACTACTTTCTCGAGAAAGTAGTGGTTGTAATCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008471
KRT19 MISSION shRNA Lentiviral Transduction Particles
keratin 19
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008471.2-514s1c1
Sequence:CCGGTCCAAGATTGTCCTACAGATTCTCGAGAATCTGTAGGACAATCTTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090553    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008471.2-1335s1c1
Sequence:CCGGCTCCCTCGACTTGTCAATAAACTCGAGTTTATTGACAAGTCGAGGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008471.2-1140s1c1
Sequence:CCGGGCGCCAGAACCAGGAGTATAACTCGAGTTATACTCCTGGTTCTGGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008471.2-874s1c1
Sequence:CCGGGCCACCTACCTTGCTCGGATTCTCGAGAATCCGAGCAAGGTAGGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008471.2-442s1c1
Sequence:CCGGCGAGATTACAACCACTACTTTCTCGAGAAAGTAGTGGTTGTAATCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002276
KRT19 MISSION shRNA Bacterial Glycerol Stock
keratin 19
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000062347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002276.3-1224s1c1
Sequence:CCGGCCAGCGGCTCATGGACATCAACTCGAGTTGATGTCCATGAGCCGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002276.3-891s1c1
Sequence:CCGGGCGAAGCCAATATGAGGTCATCTCGAGATGACCTCATATTGGCTTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002276.3-372s1c1
Sequence:CCGGCGAGAAGCTAACCATGCAGAACTCGAGTTCTGCATGGTTAGCTTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002276.3-631s1c1
Sequence:CCGGCGAACCAAGTTTGAGACGGAACTCGAGTTCCGTCTCAAACTTGGTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002276.3-1294s1c1
Sequence:CCGGCAGGAAGATCACTACAACAATCTCGAGATTGTTGTAGTGATCTTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002276.4-837s21c1
Sequence:CCGGAGGTCAGTGTGGAGGTGGATTCTCGAGAATCCACCTCCACACTGACCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002276.4-1160s21c1
Sequence:CCGGGCGCTGATCAGCGGTATTGAACTCGAGTTCAATACCGCTGATCAGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002276
KRT19 MISSION shRNA shRNA Plasmid DNA
keratin 19
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000062347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002276.3-1224s1c1
Sequence:CCGGCCAGCGGCTCATGGACATCAACTCGAGTTGATGTCCATGAGCCGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002276.3-891s1c1
Sequence:CCGGGCGAAGCCAATATGAGGTCATCTCGAGATGACCTCATATTGGCTTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002276.3-372s1c1
Sequence:CCGGCGAGAAGCTAACCATGCAGAACTCGAGTTCTGCATGGTTAGCTTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002276.3-631s1c1
Sequence:CCGGCGAACCAAGTTTGAGACGGAACTCGAGTTCCGTCTCAAACTTGGTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002276.3-1294s1c1
Sequence:CCGGCAGGAAGATCACTACAACAATCTCGAGATTGTTGTAGTGATCTTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002276.4-837s21c1
Sequence:CCGGAGGTCAGTGTGGAGGTGGATTCTCGAGAATCCACCTCCACACTGACCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002276.4-1160s21c1
Sequence:CCGGGCGCTGATCAGCGGTATTGAACTCGAGTTCAATACCGCTGATCAGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002276
KRT19 MISSION shRNA Lentiviral Transduction Particles
keratin 19
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000062347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002276.3-1224s1c1
Sequence:CCGGCCAGCGGCTCATGGACATCAACTCGAGTTGATGTCCATGAGCCGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002276.3-891s1c1
Sequence:CCGGGCGAAGCCAATATGAGGTCATCTCGAGATGACCTCATATTGGCTTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002276.3-372s1c1
Sequence:CCGGCGAGAAGCTAACCATGCAGAACTCGAGTTCTGCATGGTTAGCTTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002276.3-631s1c1
Sequence:CCGGCGAACCAAGTTTGAGACGGAACTCGAGTTCCGTCTCAAACTTGGTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002276.3-1294s1c1
Sequence:CCGGCAGGAAGATCACTACAACAATCTCGAGATTGTTGTAGTGATCTTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002276.4-837s21c1
Sequence:CCGGAGGTCAGTGTGGAGGTGGATTCTCGAGAATCCACCTCCACACTGACCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002276.4-1160s21c1
Sequence:CCGGGCGCTGATCAGCGGTATTGAACTCGAGTTCAATACCGCTGATCAGCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)