EMAIL THIS PAGE TO A FRIEND

KRT1

keratin 1

104 Gene Product Result for
Synonyms: CK1 EHK EHK1 EPPK K1 KRT1A NEPPK
UniProtKB ID: P04264, B2RA01, Q14720, Q6GSJ0, Q9H298
Gene ID:
Human(3848) Summary: The protein encoded by this gene is a member of the keratin gene family. The type II cytokeratins consist of basic or neutral proteins which are arranged in pairs of heterotypic keratin chains coexpressed during differentiation of simple and stratified epithelial tissues. This type II cytokeratin is specifically expressed in the spinous and granular layers of the epidermis with family member KRT10 and mutations in these genes have been associated with bullous congenital ichthyosiform erythroderma. The type II cytokeratins are clustered in a region of chromosome 12q12-q13. [provided by RefSeq, Jul 2008]
Mouse(16678) keratin 1
Rat(300250) keratin 1
cow(281266) keratin 1
cow(100301161) keratin 1
dog(444857) keratin 1
sheep(101109430) keratin 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA017917 Anti-KRT1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunohistochemistry pricing
SAB2101300 Anti-KRT1 antibody produced in rabbit affinity isolated antibody human, rabbit, canine
immunohistochemistry, western blot pricing
HPA062908 Anti-KRT1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
C2562 Monoclonal Anti-Cytokeratin, pan (Mixture) antibody produced in mouse clone C-11+PCK-26+CY-90+KS-1A3+M20+A53-B/A2, ascites fluid wide range
immunofluorescence, immunohistochemistry, western blot pricing
C9687 Monoclonal Anti-Cytokeratin, pan (Mixture) Prediluted antibody produced in mouse clone C-11+PCK-26+CY-90+KS-1A3+M20+A53-B/A2, ascites fluid wide range
immunohistochemistry pricing
C1801 Monoclonal Anti-Cytokeratin, pan antibody produced in mouse ascites fluid, clone PCK-26 lizard, goat, bovine, human, hamster, rat, carp, guinea pig, pig, rabbit, sheep, mouse, chicken, snake, feline, canine
immunofluorescence, immunohistochemistry, western blot pricing
C5992 Monoclonal Anti-Cytokeratin, pan antibody produced in mouse clone PCK-26, purified immunoglobulin, buffered aqueous solution lizard, goat, bovine, human, hamster, rat, carp, guinea pig, pig, rabbit, sheep, mouse, chicken, snake, feline, canine
dot blot, immunocytochemistry, immunohistochemistry, western blot pricing
F0397 Monoclonal Anti-Cytokeratin, pan−FITC antibody produced in mouse clone PCK-26, purified immunoglobulin, buffered aqueous solution lizard, goat, bovine, human, hamster, rat, carp, guinea pig, pig, rabbit, sheep, mouse, chicken, snake, feline, canine
immunofluorescence, immunohistochemistry pricing
WH0003848M1 Monoclonal Anti-KRT1 antibody produced in mouse clone 2A7, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SRE0061 Monoclonal Anti-pan-Cytokeratin clone PCK-26, Reagents designed and manufactured under cGMP controls suitable for use in an IVD application. lizard, goat, bovine, human, hamster, rat, carp, guinea pig, pig, rabbit, sheep, mouse, chicken, snake, feline, canine
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008473 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008473 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008473 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006121 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006121 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006121 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006121 Rosetta Predictions human pricing
NM_001008802 Rosetta Predictions rat pricing
NM_008473 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006121 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00203861 predicted 724
2 SASI_Hs01_00203862 predicted 1276
3 SASI_Hs01_00203864 predicted 981
4 SASI_Hs01_00203865 predicted 2065
5 SASI_Hs01_00203866 predicted 738
6 SASI_Hs02_00340947 predicted 1225
7 SASI_Hs01_00203867 predicted 1047
8 SASI_Hs02_00340948 predicted 976
9 SASI_Hs01_00203868 predicted 850
10 SASI_Hs01_00203869 predicted 798
11 SASI_Hs01_00203863 predicted 1022
12 SASI_Hs01_00203870 predicted 1215
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008802 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00099583 predicted 998
2 SASI_Rn02_00199295 predicted 1984
3 SASI_Rn01_00099584 predicted 1360
4 SASI_Rn01_00099585 predicted 914
5 SASI_Rn02_00199296 predicted 1873
6 SASI_Rn01_00099586 predicted 990
7 SASI_Rn01_00099588 predicted 903
8 SASI_Rn01_00099590 predicted 958
9 SASI_Rn01_00099591 predicted 975
10 SASI_Rn01_00099592 predicted 1067
11 SASI_Rn01_00099587 predicted 1309
12 SASI_Rn01_00099589 predicted 1189
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008473 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00313980 predicted 1921
2 SASI_Mm02_00313981 predicted 951
3 SASI_Mm01_00155350 predicted 1080
4 SASI_Mm01_00155351 predicted 1270
5 SASI_Mm01_00155353 predicted 944
6 SASI_Mm01_00155354 predicted 1337
7 SASI_Mm01_00155355 predicted 1948
8 SASI_Mm02_00313982 predicted 1058
9 SASI_Mm02_00313983 predicted 1307
10 SASI_Mm02_00313984 predicted 1318
11 SASI_Mm01_00155349 predicted 1898
12 SASI_Mm01_00155352 predicted 1480
13 SASI_Mm01_00155356 predicted 869
14 SASI_Mm01_00155357 predicted 1122
15 SASI_Mm01_00155358 predicted 1034
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008473
KRT1 MISSION shRNA Bacterial Glycerol Stock
keratin 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090788    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008473.1-2160s1c1
Sequence:CCGGCCCACTTTATGTTCTGCTGAACTCGAGTTCAGCAGAACATAAAGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008473.1-1385s1c1
Sequence:CCGGCGTGGTGAGAAAGCACTCAAACTCGAGTTTGAGTGCTTTCTCACCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008473.1-965s1c1
Sequence:CCGGGATTCAGCTTACATGACCAAACTCGAGTTTGGTCATGTAAGCTGAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008473.1-1015s1c1
Sequence:CCGGCCAGCAAGACATTAACTTCTTCTCGAGAAGAAGTTAATGTCTTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008473.1-252s1c1
Sequence:CCGGGCTTTGGAAGTAAGAGTCTTACTCGAGTAAGACTCTTACTTCCAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008473
KRT1 MISSION shRNA shRNA Plasmid DNA
keratin 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090788    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008473.1-2160s1c1
Sequence:CCGGCCCACTTTATGTTCTGCTGAACTCGAGTTCAGCAGAACATAAAGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008473.1-1385s1c1
Sequence:CCGGCGTGGTGAGAAAGCACTCAAACTCGAGTTTGAGTGCTTTCTCACCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008473.1-965s1c1
Sequence:CCGGGATTCAGCTTACATGACCAAACTCGAGTTTGGTCATGTAAGCTGAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008473.1-1015s1c1
Sequence:CCGGCCAGCAAGACATTAACTTCTTCTCGAGAAGAAGTTAATGTCTTGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008473.1-252s1c1
Sequence:CCGGGCTTTGGAAGTAAGAGTCTTACTCGAGTAAGACTCTTACTTCCAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008473
KRT1 MISSION shRNA Lentiviral Transduction Particles
keratin 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090788    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008473.1-2160s1c1
Sequence:CCGGCCCACTTTATGTTCTGCTGAACTCGAGTTCAGCAGAACATAAAGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008473.1-1385s1c1
Sequence:CCGGCGTGGTGAGAAAGCACTCAAACTCGAGTTTGAGTGCTTTCTCACCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008473.1-965s1c1
Sequence:CCGGGATTCAGCTTACATGACCAAACTCGAGTTTGGTCATGTAAGCTGAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008473.1-1015s1c1
Sequence:CCGGCCAGCAAGACATTAACTTCTTCTCGAGAAGAAGTTAATGTCTTGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008473.1-252s1c1
Sequence:CCGGGCTTTGGAAGTAAGAGTCTTACTCGAGTAAGACTCTTACTTCCAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006121
KRT1 MISSION shRNA Bacterial Glycerol Stock
keratin 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000060663    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006121.2-2317s1c1
Sequence:CCGGGCATCTTATCTCTGTGCTGTTCTCGAGAACAGCACAGAGATAAGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006121.2-706s1c1
Sequence:CCGGCCTCCACTAGAACCCATAATTCTCGAGAATTATGGGTTCTAGTGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006121.2-1028s1c1
Sequence:CCGGGACTCAAATCAGTGAAACTAACTCGAGTTAGTTTCACTGATTTGAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006121.2-1943s1c1
Sequence:CCGGGAGGTTTGTTTCTACCACTTACTCGAGTAAGTGGTAGAAACAAACCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006121.2-731s1c1
Sequence:CCGGGCCCTACTTTGAGTCATTCATCTCGAGATGAATGACTCAAAGTAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006121
KRT1 MISSION shRNA shRNA Plasmid DNA
keratin 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000060663    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006121.2-2317s1c1
Sequence:CCGGGCATCTTATCTCTGTGCTGTTCTCGAGAACAGCACAGAGATAAGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006121.2-706s1c1
Sequence:CCGGCCTCCACTAGAACCCATAATTCTCGAGAATTATGGGTTCTAGTGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006121.2-1028s1c1
Sequence:CCGGGACTCAAATCAGTGAAACTAACTCGAGTTAGTTTCACTGATTTGAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006121.2-1943s1c1
Sequence:CCGGGAGGTTTGTTTCTACCACTTACTCGAGTAAGTGGTAGAAACAAACCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006121.2-731s1c1
Sequence:CCGGGCCCTACTTTGAGTCATTCATCTCGAGATGAATGACTCAAAGTAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006121
KRT1 MISSION shRNA Lentiviral Transduction Particles
keratin 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000060663    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006121.2-2317s1c1
Sequence:CCGGGCATCTTATCTCTGTGCTGTTCTCGAGAACAGCACAGAGATAAGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006121.2-706s1c1
Sequence:CCGGCCTCCACTAGAACCCATAATTCTCGAGAATTATGGGTTCTAGTGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006121.2-1028s1c1
Sequence:CCGGGACTCAAATCAGTGAAACTAACTCGAGTTAGTTTCACTGATTTGAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006121.2-1943s1c1
Sequence:CCGGGAGGTTTGTTTCTACCACTTACTCGAGTAAGTGGTAGAAACAAACCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006121.2-731s1c1
Sequence:CCGGGCCCTACTTTGAGTCATTCATCTCGAGATGAATGACTCAAAGTAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)