EMAIL THIS PAGE TO A FRIEND

KRT20

keratin 20

73 Gene Product Result for
Synonyms: CD20 CK-20 CK20 K20 KRT21
UniProtKB ID: P35900, B2R6W7
Gene ID:
Human(54474) Summary: The protein encoded by this gene is a member of the keratin family. The keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into cytokeratins and hair keratins. The type I cytokeratins consist of acidic proteins which are arranged in pairs of heterotypic keratin chains. This cytokeratin is a major cellular protein of mature enterocytes and goblet cells and is specifically expressed in the gastric and intestinal mucosa. The type I cytokeratin genes are clustered in a region of chromosome 17q12-q21. [provided by RefSeq, Jul 2008]
Mouse(66809) keratin 20
Rat(286912) keratin 20
sheep(101111109) keratin 20
chicken(420045) keratin 20
dog(608094) keratin 20
cow(505214) keratin 20
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB5500127 Anti-Keratin 20 antibody, Rabbit monoclonal recombinant, expressed in proprietary host, clone SP33, affinity isolated antibody human (tested)
immunohistochemistry pricing
SAB4502249 Anti-Keratin 20, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
SAB2502117 Anti-KRT20 antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
SAB2502118 Anti-KRT20 antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
SAB1407549 Anti-KRT20 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
AV42529 Anti-KRT20 antibody produced in rabbit IgG fraction of antiserum human, mouse, rat, horse, rabbit, canine
western blot pricing
HPA024309 Anti-KRT20 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, Ab1 human
immunohistochemistry, western blot pricing
HPA024684 Anti-KRT20 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, Ab2 human
immunohistochemistry, western blot pricing
HPA027236 Anti-KRT20 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, Ab3 human
immunohistochemistry, western blot pricing
WH0054474M1 Monoclonal Anti-KRT20 antibody produced in mouse clone 2G3-1C8, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1405126 Monoclonal Anti-KRT20 antibody produced in mouse clone 4E5-1F2, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019010 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019010 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019010 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023256 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023256 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023256 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU129551 MISSION® esiRNA esiRNA human KRT20 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019010 Rosetta Predictions human pricing
NM_173128 Rosetta Predictions rat pricing
XM_579698 Rosetta Predictions rat pricing
NM_023256 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019010 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00242488 predicted 704
2 SASI_Hs01_00242489 predicted 571
3 SASI_Hs01_00242490 predicted 235
4 SASI_Hs01_00242491 predicted 816
5 SASI_Hs01_00242493 predicted 1083
6 SASI_Hs01_00242494 predicted 260
7 SASI_Hs01_00242495 predicted 464
8 SASI_Hs01_00242496 predicted 391
9 SASI_Hs01_00242497 predicted 1112
10 SASI_Hs02_00352538 predicted 923
11 SASI_Hs01_00242492 predicted 427
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173128 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00269296 predicted 487
2 SASI_Rn01_00040267 predicted 413
3 SASI_Rn01_00040268 predicted 805
4 SASI_Rn01_00040269 predicted 1079
5 SASI_Rn01_00040271 predicted 727
6 SASI_Rn01_00040272 predicted 936
7 SASI_Rn01_00040273 predicted 558
8 SASI_Rn01_00040274 predicted 981
9 SASI_Rn01_00040275 predicted 380
10 SASI_Rn01_00040276 predicted 833
11 SASI_Rn01_00040270 predicted 454
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579698 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00150155 predicted 1096
2 SASI_Rn01_00150156 predicted 913
3 SASI_Rn01_00150157 predicted 949
4 SASI_Rn01_00150158 predicted 991
5 SASI_Rn01_00150159 predicted 888
6 SASI_Rn01_00150160 predicted 941
7 SASI_Rn01_00150161 predicted 944
8 SASI_Rn01_00150162 predicted 1074
9 SASI_Rn01_00150163 predicted 1031
10 SASI_Rn01_00150164 predicted 988
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023256 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00097215 predicted 1127
2 SASI_Mm01_00097216 predicted 613
3 SASI_Mm01_00097217 predicted 728
4 SASI_Mm01_00097218 predicted 783
5 SASI_Mm01_00097220 predicted 565
6 SASI_Mm01_00097221 predicted 457
7 SASI_Mm01_00097222 predicted 361
8 SASI_Mm02_00327005 predicted 598
9 SASI_Mm01_00097223 predicted 908
10 SASI_Mm01_00097224 predicted 418
11 SASI_Mm01_00097219 predicted 543
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019010
KRT20 MISSION shRNA Bacterial Glycerol Stock
keratin 20
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116532    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019010.1-1383s1c1
Sequence:CCGGCCCTGCAAGAAATCAGCCATACTCGAGTATGGCTGATTTCTTGCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019010.1-538s1c1
Sequence:CCGGCGTCTAACAGTGGAAGCTGATCTCGAGATCAGCTTCCACTGTTAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019010.1-460s1c1
Sequence:CCGGCGGTGTGTCCTGCAAATTGATCTCGAGATCAATTTGCAGGACACACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019010.1-856s1c1
Sequence:CCGGGTCACAGTGAATACTGAAGAACTCGAGTTCTTCAGTATTCACTGTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019010.1-1084s1c1
Sequence:CCGGCGCCAGAACAACGAATACCATCTCGAGATGGTATTCGTTGTTCTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019010
KRT20 MISSION shRNA shRNA Plasmid DNA
keratin 20
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116532    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019010.1-1383s1c1
Sequence:CCGGCCCTGCAAGAAATCAGCCATACTCGAGTATGGCTGATTTCTTGCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019010.1-538s1c1
Sequence:CCGGCGTCTAACAGTGGAAGCTGATCTCGAGATCAGCTTCCACTGTTAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019010.1-460s1c1
Sequence:CCGGCGGTGTGTCCTGCAAATTGATCTCGAGATCAATTTGCAGGACACACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019010.1-856s1c1
Sequence:CCGGGTCACAGTGAATACTGAAGAACTCGAGTTCTTCAGTATTCACTGTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019010.1-1084s1c1
Sequence:CCGGCGCCAGAACAACGAATACCATCTCGAGATGGTATTCGTTGTTCTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019010
KRT20 MISSION shRNA Lentiviral Transduction Particles
keratin 20
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116532    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019010.1-1383s1c1
Sequence:CCGGCCCTGCAAGAAATCAGCCATACTCGAGTATGGCTGATTTCTTGCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019010.1-538s1c1
Sequence:CCGGCGTCTAACAGTGGAAGCTGATCTCGAGATCAGCTTCCACTGTTAGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019010.1-460s1c1
Sequence:CCGGCGGTGTGTCCTGCAAATTGATCTCGAGATCAATTTGCAGGACACACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019010.1-856s1c1
Sequence:CCGGGTCACAGTGAATACTGAAGAACTCGAGTTCTTCAGTATTCACTGTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019010.1-1084s1c1
Sequence:CCGGCGCCAGAACAACGAATACCATCTCGAGATGGTATTCGTTGTTCTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023256
VALIDATED
KRT20 MISSION shRNA Bacterial Glycerol Stock
keratin 20
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090203    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023256.1-1499s1c1
Sequence:CCGGGCAAGATTAAACCCAGCACAACTCGAGTTGTGCTGGGTTTAATCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023256.1-441s1c1
Sequence:CCGGGCACAGATTAAAGAGCTGCAACTCGAGTTGCAGCTCTTTAATCTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023256.1-305s1c1
Sequence:CCGGCCTGAACGACAGATTGGCAAACTCGAGTTTGCCAATCTGTCGTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023256.1-1238s1c1
Sequence:CCGGCACTTTGGAAATGAAGGATATCTCGAGATATCCTTCATTTCCAAAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023256.1-602s1c1
Sequence:CCGGCCTGAGCAAAGTTTATGATAACTCGAGTTATCATAAACTTTGCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023256.1-602s21c1
Sequence:CCGGCCTGAGCAAAGTTTATGATAACTCGAGTTATCATAAACTTTGCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023256.1-1238s21c1
Sequence:CCGGCACTTTGGAAATGAAGGATATCTCGAGATATCCTTCATTTCCAAAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023256.1-441s21c1
Sequence:CCGGGCACAGATTAAAGAGCTGCAACTCGAGTTGCAGCTCTTTAATCTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023256.1-305s21c1
Sequence:CCGGCCTGAACGACAGATTGGCAAACTCGAGTTTGCCAATCTGTCGTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023256
VALIDATED
KRT20 MISSION shRNA shRNA Plasmid DNA
keratin 20
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090203    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023256.1-1499s1c1
Sequence:CCGGGCAAGATTAAACCCAGCACAACTCGAGTTGTGCTGGGTTTAATCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023256.1-441s1c1
Sequence:CCGGGCACAGATTAAAGAGCTGCAACTCGAGTTGCAGCTCTTTAATCTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023256.1-305s1c1
Sequence:CCGGCCTGAACGACAGATTGGCAAACTCGAGTTTGCCAATCTGTCGTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023256.1-1238s1c1
Sequence:CCGGCACTTTGGAAATGAAGGATATCTCGAGATATCCTTCATTTCCAAAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023256.1-602s1c1
Sequence:CCGGCCTGAGCAAAGTTTATGATAACTCGAGTTATCATAAACTTTGCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023256.1-602s21c1
Sequence:CCGGCCTGAGCAAAGTTTATGATAACTCGAGTTATCATAAACTTTGCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023256.1-1238s21c1
Sequence:CCGGCACTTTGGAAATGAAGGATATCTCGAGATATCCTTCATTTCCAAAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023256.1-441s21c1
Sequence:CCGGGCACAGATTAAAGAGCTGCAACTCGAGTTGCAGCTCTTTAATCTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023256.1-305s21c1
Sequence:CCGGCCTGAACGACAGATTGGCAAACTCGAGTTTGCCAATCTGTCGTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023256
VALIDATED
KRT20 MISSION shRNA Lentiviral Transduction Particles
keratin 20
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090203    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023256.1-1499s1c1
Sequence:CCGGGCAAGATTAAACCCAGCACAACTCGAGTTGTGCTGGGTTTAATCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023256.1-441s1c1
Sequence:CCGGGCACAGATTAAAGAGCTGCAACTCGAGTTGCAGCTCTTTAATCTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023256.1-305s1c1
Sequence:CCGGCCTGAACGACAGATTGGCAAACTCGAGTTTGCCAATCTGTCGTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023256.1-1238s1c1
Sequence:CCGGCACTTTGGAAATGAAGGATATCTCGAGATATCCTTCATTTCCAAAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023256.1-602s1c1
Sequence:CCGGCCTGAGCAAAGTTTATGATAACTCGAGTTATCATAAACTTTGCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023256.1-602s21c1
Sequence:CCGGCCTGAGCAAAGTTTATGATAACTCGAGTTATCATAAACTTTGCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023256.1-1238s21c1
Sequence:CCGGCACTTTGGAAATGAAGGATATCTCGAGATATCCTTCATTTCCAAAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023256.1-441s21c1
Sequence:CCGGGCACAGATTAAAGAGCTGCAACTCGAGTTGCAGCTCTTTAATCTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023256.1-305s21c1
Sequence:CCGGCCTGAACGACAGATTGGCAAACTCGAGTTTGCCAATCTGTCGTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)