EMAIL THIS PAGE TO A FRIEND

KRT222

keratin 222

43 Gene Product Result for
Synonyms: KA21 KRT222P
UniProtKB ID: Q8N1A0, Q7Z368
Gene ID:
Mouse(268481) keratin 222
chicken(420046) keratin 222
cow(509747) keratin 222
dog(100687121) keratin 222
sheep(101106091) keratin 222
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172946 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172946 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172946 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152349 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152349 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152349 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152349 Rosetta Predictions human pricing
NM_172946 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152349 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00365974 predicted 904
2 SASI_Hs01_00153306 predicted 469
3 SASI_Hs02_00365975 predicted 729
4 SASI_Hs01_00153310 predicted 839
5 SASI_Hs01_00153311 predicted 580
6 SASI_Hs01_00153312 predicted 705
7 SASI_Hs01_00153313 predicted 653
8 SASI_Hs02_00365976 predicted 908
9 SASI_Hs02_00365977 predicted 796
10 SASI_Hs02_00365978 predicted 503
11 SASI_Hs01_00153305 predicted 668
12 SASI_Hs01_00153307 predicted 627
13 SASI_Hs01_00153308 predicted 813
14 SASI_Hs01_00153309 predicted 219
15 SASI_Hs01_00153314 predicted 666
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172946 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00033883 predicted 684
2 SASI_Mm01_00033884 predicted 1384
3 SASI_Mm01_00033885 predicted 806
4 SASI_Mm01_00033886 predicted 1376
5 SASI_Mm01_00033887 predicted 1348
6 SASI_Mm01_00033889 predicted 838
7 SASI_Mm01_00033890 predicted 633
8 SASI_Mm01_00033891 predicted 822
9 SASI_Mm02_00344980 predicted 515
10 SASI_Mm01_00033892 predicted 460
11 SASI_Mm01_00033888 predicted 521
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172946
KRT222 MISSION shRNA Bacterial Glycerol Stock
keratin 222
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090198    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172946.1-1206s1c1
Sequence:CCGGGCGAGCTTTATCAGAGACTTTCTCGAGAAAGTCTCTGATAAAGCTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172946.1-126s1c1
Sequence:CCGGGCTAGAGGAAGATATAACCAACTCGAGTTGGTTATATCTTCCTCTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172946.1-452s1c1
Sequence:CCGGGCCTGCTAGAACAGGAAGAAACTCGAGTTTCTTCCTGTTCTAGCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172946.1-399s1c1
Sequence:CCGGGATGCTTCTCAACACGAAGATCTCGAGATCTTCGTGTTGAGAAGCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172946.1-838s1c1
Sequence:CCGGCCAGATATCGAAGTCAGACTTCTCGAGAAGTCTGACTTCGATATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172946
KRT222 MISSION shRNA shRNA Plasmid DNA
keratin 222
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090198    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172946.1-1206s1c1
Sequence:CCGGGCGAGCTTTATCAGAGACTTTCTCGAGAAAGTCTCTGATAAAGCTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172946.1-126s1c1
Sequence:CCGGGCTAGAGGAAGATATAACCAACTCGAGTTGGTTATATCTTCCTCTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172946.1-452s1c1
Sequence:CCGGGCCTGCTAGAACAGGAAGAAACTCGAGTTTCTTCCTGTTCTAGCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172946.1-399s1c1
Sequence:CCGGGATGCTTCTCAACACGAAGATCTCGAGATCTTCGTGTTGAGAAGCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172946.1-838s1c1
Sequence:CCGGCCAGATATCGAAGTCAGACTTCTCGAGAAGTCTGACTTCGATATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172946
KRT222 MISSION shRNA Lentiviral Transduction Particles
keratin 222
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090198    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172946.1-1206s1c1
Sequence:CCGGGCGAGCTTTATCAGAGACTTTCTCGAGAAAGTCTCTGATAAAGCTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172946.1-126s1c1
Sequence:CCGGGCTAGAGGAAGATATAACCAACTCGAGTTGGTTATATCTTCCTCTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172946.1-452s1c1
Sequence:CCGGGCCTGCTAGAACAGGAAGAAACTCGAGTTTCTTCCTGTTCTAGCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172946.1-399s1c1
Sequence:CCGGGATGCTTCTCAACACGAAGATCTCGAGATCTTCGTGTTGAGAAGCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172946.1-838s1c1
Sequence:CCGGCCAGATATCGAAGTCAGACTTCTCGAGAAGTCTGACTTCGATATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152349
VALIDATED
KRT222 MISSION shRNA Bacterial Glycerol Stock
keratin 222
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_152349.1-306s1c1
Sequence:CCGGGCAAGACCTAGAGACTGTGATCTCGAGATCACAGTCTCTAGGTCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152349.1-823s1c1
Sequence:CCGGCAGGATAATCTACCAGATATACTCGAGTATATCTGGTAGATTATCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_152349.1-793s1c1
Sequence:CCGGGCCACTGATGAAGGGTGTTTACTCGAGTAAACACCCTTCATCAGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152349.1-880s1c1
Sequence:CCGGCCCTCTATCAAACCTCCATCACTCGAGTGATGGAGGTTTGATAGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_152349.1-881s1c1
Sequence:CCGGCCTCTATCAAACCTCCATCAACTCGAGTTGATGGAGGTTTGATAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152349
VALIDATED
KRT222 MISSION shRNA shRNA Plasmid DNA
keratin 222
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_152349.1-306s1c1
Sequence:CCGGGCAAGACCTAGAGACTGTGATCTCGAGATCACAGTCTCTAGGTCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152349.1-823s1c1
Sequence:CCGGCAGGATAATCTACCAGATATACTCGAGTATATCTGGTAGATTATCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_152349.1-793s1c1
Sequence:CCGGGCCACTGATGAAGGGTGTTTACTCGAGTAAACACCCTTCATCAGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152349.1-880s1c1
Sequence:CCGGCCCTCTATCAAACCTCCATCACTCGAGTGATGGAGGTTTGATAGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_152349.1-881s1c1
Sequence:CCGGCCTCTATCAAACCTCCATCAACTCGAGTTGATGGAGGTTTGATAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152349
VALIDATED
KRT222 MISSION shRNA Lentiviral Transduction Particles
keratin 222
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_152349.1-306s1c1
Sequence:CCGGGCAAGACCTAGAGACTGTGATCTCGAGATCACAGTCTCTAGGTCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152349.1-823s1c1
Sequence:CCGGCAGGATAATCTACCAGATATACTCGAGTATATCTGGTAGATTATCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_152349.1-793s1c1
Sequence:CCGGGCCACTGATGAAGGGTGTTTACTCGAGTAAACACCCTTCATCAGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152349.1-880s1c1
Sequence:CCGGCCCTCTATCAAACCTCCATCACTCGAGTGATGGAGGTTTGATAGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_152349.1-881s1c1
Sequence:CCGGCCTCTATCAAACCTCCATCAACTCGAGTTGATGGAGGTTTGATAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)