EMAIL THIS PAGE TO A FRIEND

KRT23

keratin 23 (histone deacetylase inducible)

67 Gene Product Result for
Synonyms: CK23 HAIK1 K23
UniProtKB ID: Q9C075, A8K084, Q9NUR6
Gene ID:
Human(25984) Summary: The protein encoded by this gene is a member of the keratin family. The keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into cytokeratins and hair keratins. The type I cytokeratins consist of acidic proteins which are arranged in pairs of heterotypic keratin chains. The type I cytokeratin genes are clustered in a region of chromosome 17q12-q21. [provided by RefSeq, Jul 2008]
Mouse(94179) keratin 23
Rat(287678) keratin 23 (histone deacetylase inducible)
chicken(420044) keratin 23 (histone deacetylase inducible)
cow(510914) keratin 23 (histone deacetylase inducible)
Horse(100067426) keratin 23 (histone deacetylase inducible)
domestic cat(101086610) keratin 23 (histone deacetylase inducible)
dog(491005) keratin 23 (histone deacetylase inducible)
sheep(101111379) keratin 23 (histone deacetylase inducible)
domestic guinea pig(100730066) keratin 23 (histone deacetylase inducible)
naked mole-rat(101715514) keratin 23 (histone deacetylase inducible)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015515 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015515 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015515 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_033373 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_033373 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_033373 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015515 Rosetta Predictions human pricing
NM_001008753 Rosetta Predictions rat pricing
XM_579204 Rosetta Predictions rat pricing
NM_033373 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015515 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00230512 predicted 1006
2 SASI_Hs02_00348010 predicted 1735
3 SASI_Hs01_00230513 predicted 1714
4 SASI_Hs01_00230514 predicted 1349
5 SASI_Hs01_00230515 predicted 995
6 SASI_Hs01_00230516 predicted 1314
7 SASI_Hs01_00230517 predicted 1123
8 SASI_Hs01_00230518 predicted 1146
9 SASI_Hs01_00230519 predicted 992
10 SASI_Hs01_00230520 predicted 930
11 SASI_Hs01_00230521 predicted 980
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008753 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00047380 predicted 731
2 SASI_Rn01_00047381 predicted 940
3 SASI_Rn01_00047382 predicted 1023
4 SASI_Rn01_00047383 predicted 866
5 SASI_Rn01_00047384 predicted 320
6 SASI_Rn02_00199258 predicted 916
7 SASI_Rn01_00047385 predicted 938
8 SASI_Rn01_00047386 predicted 737
9 SASI_Rn01_00047388 predicted 656
10 SASI_Rn01_00047389 predicted 843
11 SASI_Rn01_00047387 predicted 620
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579204 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00164531 predicted 740
2 SASI_Rn01_00164532 predicted 943
3 SASI_Rn01_00164533 predicted 1029
4 SASI_Rn01_00164534 predicted 877
5 SASI_Rn01_00164535 predicted 913
6 SASI_Rn01_00164536 predicted 943
7 SASI_Rn01_00164537 predicted 737
8 SASI_Rn01_00164538 predicted 849
9 SASI_Rn01_00164539 predicted 976
10 SASI_Rn01_00164540 predicted 1045
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033373 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00195502 predicted 1212
2 SASI_Mm02_00337344 predicted 778
3 SASI_Mm01_00195503 predicted 641
4 SASI_Mm01_00195504 predicted 882
5 SASI_Mm01_00195505 predicted 541
6 SASI_Mm01_00195507 predicted 449
7 SASI_Mm01_00195508 predicted 1042
8 SASI_Mm02_00337345 predicted 1230
9 SASI_Mm01_00195509 predicted 1247
10 SASI_Mm01_00195510 predicted 1196
11 SASI_Mm01_00195506 predicted 922
12 SASI_Mm01_00195511 predicted 1042
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015515
KRT23 MISSION shRNA Bacterial Glycerol Stock
keratin 23 (histone deacetylase inducible)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000038899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015515.3-1010s1c1
Sequence:CCGGGCTCAGATTATTCTTCTCATTCTCGAGAATGAGAAGAATAATCTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015515.3-1506s1c1
Sequence:CCGGGCACGAAATCTGCTTTGGAAACTCGAGTTTCCAAAGCAGATTTCGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015515.3-1086s1c1
Sequence:CCGGCCTTTAAGAAAGACTTGGAAACTCGAGTTTCCAAGTCTTTCTTAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015515.3-1827s1c1
Sequence:CCGGGTCAAGTGAATGAAATCCAAACTCGAGTTTGGATTTCATTCACTTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015515.3-1634s1c1
Sequence:CCGGCGGCAGAACAATGAATACCAACTCGAGTTGGTATTCATTGTTCTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015515
KRT23 MISSION shRNA shRNA Plasmid DNA
keratin 23 (histone deacetylase inducible)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000038899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015515.3-1010s1c1
Sequence:CCGGGCTCAGATTATTCTTCTCATTCTCGAGAATGAGAAGAATAATCTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015515.3-1506s1c1
Sequence:CCGGGCACGAAATCTGCTTTGGAAACTCGAGTTTCCAAAGCAGATTTCGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015515.3-1086s1c1
Sequence:CCGGCCTTTAAGAAAGACTTGGAAACTCGAGTTTCCAAGTCTTTCTTAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015515.3-1827s1c1
Sequence:CCGGGTCAAGTGAATGAAATCCAAACTCGAGTTTGGATTTCATTCACTTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015515.3-1634s1c1
Sequence:CCGGCGGCAGAACAATGAATACCAACTCGAGTTGGTATTCATTGTTCTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015515
KRT23 MISSION shRNA Lentiviral Transduction Particles
keratin 23 (histone deacetylase inducible)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000038899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015515.3-1010s1c1
Sequence:CCGGGCTCAGATTATTCTTCTCATTCTCGAGAATGAGAAGAATAATCTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015515.3-1506s1c1
Sequence:CCGGGCACGAAATCTGCTTTGGAAACTCGAGTTTCCAAAGCAGATTTCGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015515.3-1086s1c1
Sequence:CCGGCCTTTAAGAAAGACTTGGAAACTCGAGTTTCCAAGTCTTTCTTAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015515.3-1827s1c1
Sequence:CCGGGTCAAGTGAATGAAATCCAAACTCGAGTTTGGATTTCATTCACTTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015515.3-1634s1c1
Sequence:CCGGCGGCAGAACAATGAATACCAACTCGAGTTGGTATTCATTGTTCTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033373
KRT23 MISSION shRNA Bacterial Glycerol Stock
keratin 23 (histone deacetylase inducible)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091168    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033373.1-1395s1c1
Sequence:CCGGCGACGGAAATCCTTGGAGTTTCTCGAGAAACTCCAAGGATTTCCGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033373.1-779s1c1
Sequence:CCGGAGGCAGGAATACGAGTTAATACTCGAGTATTAACTCGTATTCCTGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033373.1-778s1c1
Sequence:CCGGGAGGCAGGAATACGAGTTAATCTCGAGATTAACTCGTATTCCTGCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033373.1-509s1c1
Sequence:CCGGGATGACTTCAACCTGAAGTTTCTCGAGAAACTTCAGGTTGAAGTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033373.1-1090s1c1
Sequence:CCGGGCGTCAGAACAATGAACACAACTCGAGTTGTGTTCATTGTTCTGACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033373
KRT23 MISSION shRNA shRNA Plasmid DNA
keratin 23 (histone deacetylase inducible)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091168    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033373.1-1395s1c1
Sequence:CCGGCGACGGAAATCCTTGGAGTTTCTCGAGAAACTCCAAGGATTTCCGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033373.1-779s1c1
Sequence:CCGGAGGCAGGAATACGAGTTAATACTCGAGTATTAACTCGTATTCCTGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033373.1-778s1c1
Sequence:CCGGGAGGCAGGAATACGAGTTAATCTCGAGATTAACTCGTATTCCTGCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033373.1-509s1c1
Sequence:CCGGGATGACTTCAACCTGAAGTTTCTCGAGAAACTTCAGGTTGAAGTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033373.1-1090s1c1
Sequence:CCGGGCGTCAGAACAATGAACACAACTCGAGTTGTGTTCATTGTTCTGACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033373
KRT23 MISSION shRNA Lentiviral Transduction Particles
keratin 23 (histone deacetylase inducible)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091168    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033373.1-1395s1c1
Sequence:CCGGCGACGGAAATCCTTGGAGTTTCTCGAGAAACTCCAAGGATTTCCGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033373.1-779s1c1
Sequence:CCGGAGGCAGGAATACGAGTTAATACTCGAGTATTAACTCGTATTCCTGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033373.1-778s1c1
Sequence:CCGGGAGGCAGGAATACGAGTTAATCTCGAGATTAACTCGTATTCCTGCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033373.1-509s1c1
Sequence:CCGGGATGACTTCAACCTGAAGTTTCTCGAGAAACTTCAGGTTGAAGTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033373.1-1090s1c1
Sequence:CCGGGCGTCAGAACAATGAACACAACTCGAGTTGTGTTCATTGTTCTGACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)