EMAIL THIS PAGE TO A FRIEND

KRT24

keratin 24

92 Gene Product Result for
Synonyms: K24 KA24
UniProtKB ID: Q2M2I5, Q9NXG7
Gene ID:
Human(192666) Summary: This gene encodes a member of the type I (acidic) keratin family, which belongs to the superfamily of intermediate filament (IF) proteins. Keratins are heteropolymeric structural proteins which form the intermediate filament. These filaments, along with actin microfilaments and microtubules, compose the cytoskeleton of epithelial cells. The type I keratin genes are clustered in a region of chromosome 17q12-q21. [provided by RefSeq, Jun 2009]
Mouse(75706) keratin 24
Rat(287675) keratin 24
sheep(101110156) keratin 24
dog(491009) keratin 24
cow(788424) keratin 24
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_126660 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_126660 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_126660 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_019016 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019016 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019016 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU013061 MISSION® esiRNA esiRNA targeting human KRT24 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019016 Rosetta Predictions human pricing
NM_001004131 Rosetta Predictions rat pricing
XM_579130 Rosetta Predictions rat pricing
NM_029393 Rosetta Predictions mouse pricing
XM_001001218 Rosetta Predictions mouse pricing
XM_001001230 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019016 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00042082 predicted 632
2 SASI_Hs02_00352545 predicted 545
3 SASI_Hs01_00042083 predicted 1309
4 SASI_Hs01_00042086 predicted 1129
5 SASI_Hs01_00042087 predicted 359
6 SASI_Hs01_00042088 predicted 1338
7 SASI_Hs01_00042089 predicted 1124
8 SASI_Hs02_00352546 predicted 866
9 SASI_Hs01_00042091 predicted 667
10 SASI_Hs02_00352547 predicted 1251
11 SASI_Hs01_00042084 predicted 675
12 SASI_Hs01_00042085 predicted 480
13 SASI_Hs01_00042090 predicted 622
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004131 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00034804 predicted 533
2 SASI_Rn01_00034805 predicted 543
3 SASI_Rn01_00034806 predicted 682
4 SASI_Rn01_00034807 predicted 496
5 SASI_Rn01_00034808 predicted 984
6 SASI_Rn01_00034809 predicted 853
7 SASI_Rn01_00034811 predicted 661
8 SASI_Rn01_00034812 predicted 425
9 SASI_Rn02_00198161 predicted 517
10 SASI_Rn01_00034813 predicted 1065
11 SASI_Rn01_00034810 predicted 717
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579130 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00156211 predicted 272
2 SASI_Rn01_00156212 predicted 812
3 SASI_Rn01_00156213 predicted 537
4 SASI_Rn01_00156214 predicted 491
5 SASI_Rn01_00156215 predicted 739
6 SASI_Rn01_00156216 predicted 545
7 SASI_Rn01_00156217 predicted 681
8 SASI_Rn01_00156218 predicted 685
9 SASI_Rn01_00156219 predicted 511
10 SASI_Rn01_00156220 predicted 358
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029393 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00335281 predicted 591
2 SASI_Mm02_00335282 predicted 638
3 SASI_Mm02_00335283 predicted 452
4 SASI_Mm02_00335284 predicted 1081
5 SASI_Mm02_00335285 predicted 778
6 SASI_Mm02_00335286 predicted 602
7 SASI_Mm02_00335287 predicted 1104
8 SASI_Mm02_00335288 predicted 1081
9 SASI_Mm02_00335289 predicted 371
10 SASI_Mm02_00335290 predicted 1207
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001001218 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00214108 predicted 619
2 SASI_Mm01_00214109 predicted 589
3 SASI_Mm01_00214110 predicted 668
4 SASI_Mm01_00214111 predicted 660
5 SASI_Mm01_00214112 predicted 630
6 SASI_Mm01_00214113 predicted 728
7 SASI_Mm01_00214114 predicted 629
8 SASI_Mm01_00214115 predicted 696
9 SASI_Mm01_00214116 predicted 632
10 SASI_Mm01_00214117 predicted 670
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001001230 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00225096 predicted 624
2 SASI_Mm01_00225097 predicted 587
3 SASI_Mm01_00225098 predicted 666
4 SASI_Mm01_00225099 predicted 663
5 SASI_Mm01_00225100 predicted 630
6 SASI_Mm01_00225101 predicted 728
7 SASI_Mm01_00225102 predicted 628
8 SASI_Mm01_00225103 predicted 692
9 SASI_Mm01_00225104 predicted 626
10 SASI_Mm01_00225105 predicted 662
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_126660
KRT24 MISSION shRNA Bacterial Glycerol Stock
keratin 24
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090673    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_126660.1-1605s1c1
Sequence:CCGGGATCAGCAGGACATCCATCAACTCGAGTTGATGGATGTCCTGCTGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126660.1-1564s1c1
Sequence:CCGGCAGCAACATTTCTGAAGTGAACTCGAGTTCACTTCAGAAATGTTGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126660.1-625s1c1
Sequence:CCGGCTACAGCCAATACTACTCAATCTCGAGATTGAGTAGTATTGGCTGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126660.1-1121s1c1
Sequence:CCGGGCCAGGAGTGAAGTAATGGAACTCGAGTTCCATTACTTCACTCCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126660.1-509s1c1
Sequence:CCGGCTAGCCAACTACCTAGACAAACTCGAGTTTGTCTAGGTAGTTGGCTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_126660
KRT24 MISSION shRNA shRNA Plasmid DNA
keratin 24
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090673    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_126660.1-1605s1c1
Sequence:CCGGGATCAGCAGGACATCCATCAACTCGAGTTGATGGATGTCCTGCTGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126660.1-1564s1c1
Sequence:CCGGCAGCAACATTTCTGAAGTGAACTCGAGTTCACTTCAGAAATGTTGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126660.1-625s1c1
Sequence:CCGGCTACAGCCAATACTACTCAATCTCGAGATTGAGTAGTATTGGCTGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126660.1-1121s1c1
Sequence:CCGGGCCAGGAGTGAAGTAATGGAACTCGAGTTCCATTACTTCACTCCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126660.1-509s1c1
Sequence:CCGGCTAGCCAACTACCTAGACAAACTCGAGTTTGTCTAGGTAGTTGGCTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_126660
KRT24 MISSION shRNA Lentiviral Transduction Particles
keratin 24
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090673    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_126660.1-1605s1c1
Sequence:CCGGGATCAGCAGGACATCCATCAACTCGAGTTGATGGATGTCCTGCTGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126660.1-1564s1c1
Sequence:CCGGCAGCAACATTTCTGAAGTGAACTCGAGTTCACTTCAGAAATGTTGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126660.1-625s1c1
Sequence:CCGGCTACAGCCAATACTACTCAATCTCGAGATTGAGTAGTATTGGCTGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126660.1-1121s1c1
Sequence:CCGGGCCAGGAGTGAAGTAATGGAACTCGAGTTCCATTACTTCACTCCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126660.1-509s1c1
Sequence:CCGGCTAGCCAACTACCTAGACAAACTCGAGTTTGTCTAGGTAGTTGGCTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019016
KRT24 MISSION shRNA Bacterial Glycerol Stock
keratin 24
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116672    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019016.1-1714s1c1
Sequence:CCGGCTAGGCATCTTTCTGGATAATCTCGAGATTATCCAGAAAGATGCCTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019016.1-1526s1c1
Sequence:CCGGGACGAGATTCAAGCAAGACTACTCGAGTAGTCTTGCTTGAATCTCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019016.1-1517s1c1
Sequence:CCGGCTGGTCAAGGACGAGATTCAACTCGAGTTGAATCTCGTCCTTGACCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019016.1-1595s1c1
Sequence:CCGGCGTCTCAAGTCAGCAGTATTTCTCGAGAAATACTGCTGACTTGAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019016.1-620s1c1
Sequence:CCGGCGGGAAGAGATTATAGCAAATCTCGAGATTTGCTATAATCTCTTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019016
KRT24 MISSION shRNA shRNA Plasmid DNA
keratin 24
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116672    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019016.1-1714s1c1
Sequence:CCGGCTAGGCATCTTTCTGGATAATCTCGAGATTATCCAGAAAGATGCCTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019016.1-1526s1c1
Sequence:CCGGGACGAGATTCAAGCAAGACTACTCGAGTAGTCTTGCTTGAATCTCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019016.1-1517s1c1
Sequence:CCGGCTGGTCAAGGACGAGATTCAACTCGAGTTGAATCTCGTCCTTGACCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019016.1-1595s1c1
Sequence:CCGGCGTCTCAAGTCAGCAGTATTTCTCGAGAAATACTGCTGACTTGAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019016.1-620s1c1
Sequence:CCGGCGGGAAGAGATTATAGCAAATCTCGAGATTTGCTATAATCTCTTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019016
KRT24 MISSION shRNA Lentiviral Transduction Particles
keratin 24
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116672    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019016.1-1714s1c1
Sequence:CCGGCTAGGCATCTTTCTGGATAATCTCGAGATTATCCAGAAAGATGCCTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019016.1-1526s1c1
Sequence:CCGGGACGAGATTCAAGCAAGACTACTCGAGTAGTCTTGCTTGAATCTCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019016.1-1517s1c1
Sequence:CCGGCTGGTCAAGGACGAGATTCAACTCGAGTTGAATCTCGTCCTTGACCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019016.1-1595s1c1
Sequence:CCGGCGTCTCAAGTCAGCAGTATTTCTCGAGAAATACTGCTGACTTGAGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019016.1-620s1c1
Sequence:CCGGCGGGAAGAGATTATAGCAAATCTCGAGATTTGCTATAATCTCTTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)