EMAIL THIS PAGE TO A FRIEND

KRT25

keratin 25

78 Gene Product Result for
Synonyms: KRT25A
UniProtKB ID: Q7Z3Z0
Gene ID:
Human(147183) Summary: This gene encodes a member of the type I (acidic) keratin family, which belongs to the superfamily of intermediate filament (IF) proteins. Keratins are heteropolymeric structural proteins which form the intermediate filament. These filaments, along with actin microfilaments and microtubules, compose the cytoskeleton of epithelial cells. The type I keratin genes are clustered in a region of chromosome 17q12-q21. [provided by RefSeq, Jul 2009]
Mouse(70810) keratin 25
Rat(303519) keratin 25
dog(100686957) keratin 25
Horse(100054031) keratin 25
cow(785186) keratin 25-like
cow(511540) keratin 25
Goat(100861172) keratin 25
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181534 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181534 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181534 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133730 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133730 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133730 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU165901 MISSION® esiRNA esiRNA targeting mouse Krt25 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181534 Rosetta Predictions human pricing
NM_001008822 Rosetta Predictions rat pricing
XM_579219 Rosetta Predictions rat pricing
NM_133730 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181534 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00068325 predicted 1198
2 SASI_Hs02_00370152 predicted 1371
3 SASI_Hs01_00068326 predicted 1379
4 SASI_Hs01_00068327 predicted 486
5 SASI_Hs01_00068328 predicted 459
6 SASI_Hs01_00068329 predicted 637
7 SASI_Hs01_00068330 predicted 587
8 SASI_Hs01_00068331 predicted 492
9 SASI_Hs01_00068332 predicted 1304
10 SASI_Hs02_00370153 predicted 1386
11 SASI_Hs01_00068333 predicted 697
12 SASI_Hs01_00068334 predicted 501
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008822 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00099784 predicted 922
2 SASI_Rn01_00099785 predicted 389
3 SASI_Rn01_00099786 predicted 342
4 SASI_Rn01_00099787 predicted 867
5 SASI_Rn02_00199313 predicted 440
6 SASI_Rn01_00099789 predicted 407
7 SASI_Rn01_00099790 predicted 473
8 SASI_Rn01_00099791 predicted 866
9 SASI_Rn01_00099792 predicted 867
10 SASI_Rn01_00099793 predicted 898
11 SASI_Rn01_00099788 predicted 930
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579219 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00182887 predicted 933
2 SASI_Rn01_00182888 predicted 397
3 SASI_Rn01_00182889 predicted 346
4 SASI_Rn01_00182890 predicted 877
5 SASI_Rn01_00182891 predicted 936
6 SASI_Rn01_00182892 predicted 418
7 SASI_Rn01_00182893 predicted 485
8 SASI_Rn01_00182894 predicted 867
9 SASI_Rn01_00182895 predicted 871
10 SASI_Rn01_00182896 predicted 905
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133730 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00023112 predicted 978
2 SASI_Mm01_00023114 predicted 913
3 SASI_Mm01_00023115 predicted 1206
4 SASI_Mm01_00023116 predicted 1220
5 SASI_Mm01_00023117 predicted 1247
6 SASI_Mm01_00023118 predicted 1233
7 SASI_Mm01_00023119 predicted 981
8 SASI_Mm01_00023120 predicted 1224
9 SASI_Mm01_00023121 predicted 1246
10 SASI_Mm02_00338710 predicted 915
11 SASI_Mm01_00023113 predicted 253
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181534
KRT25 MISSION shRNA Bacterial Glycerol Stock
keratin 25
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116492    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181534.2-1445s1c1
Sequence:CCGGGCATTATGTATCTGTCCAGAACTCGAGTTCTGGACAGATACATAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181534.2-926s1c1
Sequence:CCGGCCCGGAATGAGCTGACTGAAACTCGAGTTTCAGTCAGCTCATTCCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181534.2-524s1c1
Sequence:CCGGCCAGGCTTACAGCTGATGATTCTCGAGAATCATCAGCTGTAAGCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181534.2-1297s1c1
Sequence:CCGGGCCATAGTGGTTAAGAAAGTTCTCGAGAACTTTCTTAACCACTATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181534.2-125s1c1
Sequence:CCGGCCAGCTTTGGTACTGGAAATTCTCGAGAATTTCCAGTACCAAAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181534.3-603s21c1
Sequence:CCGGGTGTAGAGGCTGATGTCAATGCTCGAGCATTGACATCAGCCTCTACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181534.3-1203s21c1
Sequence:CCGGAGACCTACTGTCTCCTTATAGCTCGAGCTATAAGGAGACAGTAGGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181534.3-663s21c1
Sequence:CCGGCAGATCTGGAGATTCAGTATGCTCGAGCATACTGAATCTCCAGATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181534.3-114s21c1
Sequence:CCGGCTGGATCACTCAGACTCTATGCTCGAGCATAGAGTCTGAGTGATCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181534
KRT25 MISSION shRNA shRNA Plasmid DNA
keratin 25
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116492    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181534.2-1445s1c1
Sequence:CCGGGCATTATGTATCTGTCCAGAACTCGAGTTCTGGACAGATACATAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181534.2-926s1c1
Sequence:CCGGCCCGGAATGAGCTGACTGAAACTCGAGTTTCAGTCAGCTCATTCCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181534.2-524s1c1
Sequence:CCGGCCAGGCTTACAGCTGATGATTCTCGAGAATCATCAGCTGTAAGCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181534.2-1297s1c1
Sequence:CCGGGCCATAGTGGTTAAGAAAGTTCTCGAGAACTTTCTTAACCACTATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181534.2-125s1c1
Sequence:CCGGCCAGCTTTGGTACTGGAAATTCTCGAGAATTTCCAGTACCAAAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181534.3-603s21c1
Sequence:CCGGGTGTAGAGGCTGATGTCAATGCTCGAGCATTGACATCAGCCTCTACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181534.3-1203s21c1
Sequence:CCGGAGACCTACTGTCTCCTTATAGCTCGAGCTATAAGGAGACAGTAGGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181534.3-663s21c1
Sequence:CCGGCAGATCTGGAGATTCAGTATGCTCGAGCATACTGAATCTCCAGATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181534.3-114s21c1
Sequence:CCGGCTGGATCACTCAGACTCTATGCTCGAGCATAGAGTCTGAGTGATCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181534
KRT25 MISSION shRNA Lentiviral Transduction Particles
keratin 25
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116492    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181534.2-1445s1c1
Sequence:CCGGGCATTATGTATCTGTCCAGAACTCGAGTTCTGGACAGATACATAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181534.2-926s1c1
Sequence:CCGGCCCGGAATGAGCTGACTGAAACTCGAGTTTCAGTCAGCTCATTCCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181534.2-524s1c1
Sequence:CCGGCCAGGCTTACAGCTGATGATTCTCGAGAATCATCAGCTGTAAGCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181534.2-1297s1c1
Sequence:CCGGGCCATAGTGGTTAAGAAAGTTCTCGAGAACTTTCTTAACCACTATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181534.2-125s1c1
Sequence:CCGGCCAGCTTTGGTACTGGAAATTCTCGAGAATTTCCAGTACCAAAGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181534.3-603s21c1
Sequence:CCGGGTGTAGAGGCTGATGTCAATGCTCGAGCATTGACATCAGCCTCTACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181534.3-1203s21c1
Sequence:CCGGAGACCTACTGTCTCCTTATAGCTCGAGCTATAAGGAGACAGTAGGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181534.3-663s21c1
Sequence:CCGGCAGATCTGGAGATTCAGTATGCTCGAGCATACTGAATCTCCAGATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181534.3-114s21c1
Sequence:CCGGCTGGATCACTCAGACTCTATGCTCGAGCATAGAGTCTGAGTGATCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133730
KRT25 MISSION shRNA Bacterial Glycerol Stock
keratin 25
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133730.1-1333s1c1
Sequence:CCGGGCAGCAAGATACTGACCACTACTCGAGTAGTGGTCAGTATCTTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090288    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133730.1-1493s1c1
Sequence:CCGGCCTGTTGTCTTCTGTTCCTTTCTCGAGAAAGGAACAGAAGACAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133730.1-1263s1c1
Sequence:CCGGGCCGGAAACCAAATCAAAGATCTCGAGATCTTTGATTTGGTTTCCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133730.1-1224s1c1
Sequence:CCGGTCTTCGAGTTACAAGTCTAAACTCGAGTTTAGACTTGTAACTCGAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133730.1-643s1c1
Sequence:CCGGACCTGGAGATTCAGTACGAAACTCGAGTTTCGTACTGAATCTCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133730
KRT25 MISSION shRNA shRNA Plasmid DNA
keratin 25
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133730.1-1333s1c1
Sequence:CCGGGCAGCAAGATACTGACCACTACTCGAGTAGTGGTCAGTATCTTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090288    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133730.1-1493s1c1
Sequence:CCGGCCTGTTGTCTTCTGTTCCTTTCTCGAGAAAGGAACAGAAGACAACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133730.1-1263s1c1
Sequence:CCGGGCCGGAAACCAAATCAAAGATCTCGAGATCTTTGATTTGGTTTCCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133730.1-1224s1c1
Sequence:CCGGTCTTCGAGTTACAAGTCTAAACTCGAGTTTAGACTTGTAACTCGAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133730.1-643s1c1
Sequence:CCGGACCTGGAGATTCAGTACGAAACTCGAGTTTCGTACTGAATCTCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133730
KRT25 MISSION shRNA Lentiviral Transduction Particles
keratin 25
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133730.1-1333s1c1
Sequence:CCGGGCAGCAAGATACTGACCACTACTCGAGTAGTGGTCAGTATCTTGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090288    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133730.1-1493s1c1
Sequence:CCGGCCTGTTGTCTTCTGTTCCTTTCTCGAGAAAGGAACAGAAGACAACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133730.1-1263s1c1
Sequence:CCGGGCCGGAAACCAAATCAAAGATCTCGAGATCTTTGATTTGGTTTCCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133730.1-1224s1c1
Sequence:CCGGTCTTCGAGTTACAAGTCTAAACTCGAGTTTAGACTTGTAACTCGAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133730.1-643s1c1
Sequence:CCGGACCTGGAGATTCAGTACGAAACTCGAGTTTCGTACTGAATCTCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)