EMAIL THIS PAGE TO A FRIEND

KRT26

keratin 26

46 Gene Product Result for
Synonyms: CK26 K25IRS2 K26 KRT25B
UniProtKB ID: Q7Z3Y9, A2RUL2, B2RNH8
Gene ID:
Human(353288) Summary: The protein encoded by this gene is a member of the keratin superfamily. This keratin protein is a type I keratin that is specific for the inner root sheath of the hair follicle. This gene exists in a cluster with other keratin genes on chromosome 17q21. [provided by RefSeq, Jul 2009]
Mouse(320864) keratin 26
Rat(407758) keratin 26
sheep(101110427) keratin 26
dog(491008) keratin 26
cow(788900) keratin, type I cytoskeletal 26-like
cow(539216) keratin 26
Horse(100067606) keratin 26
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181539 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181539 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181539 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_109734 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_109734 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_109734 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU203421 MISSION® esiRNA esiRNA targeting mouse Krt26 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181539 Rosetta Predictions human pricing
NM_001008823 Rosetta Predictions rat pricing
NM_001033397 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181539 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00100221 predicted 790
2 SASI_Hs01_00100222 predicted 942
3 SASI_Hs01_00100223 predicted 456
4 SASI_Hs01_00100224 predicted 1073
5 SASI_Hs01_00100225 predicted 436
6 SASI_Hs01_00100226 predicted 1005
7 SASI_Hs01_00100227 predicted 448
8 SASI_Hs01_00100228 predicted 478
9 SASI_Hs01_00100229 predicted 1051
10 SASI_Hs01_00100230 predicted 1059
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008823 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00060531 predicted 734
2 SASI_Rn02_00199314 predicted 434
3 SASI_Rn01_00060533 predicted 402
4 SASI_Rn01_00060534 predicted 267
5 SASI_Rn01_00060535 predicted 833
6 SASI_Rn01_00060536 predicted 866
7 SASI_Rn01_00060537 predicted 847
8 SASI_Rn01_00060538 predicted 830
9 SASI_Rn01_00060539 predicted 713
10 SASI_Rn02_00199315 predicted 494
11 SASI_Rn01_00060532 predicted 848
12 SASI_Rn01_00060540 predicted 893
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033397 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00088823 predicted 654
2 SASI_Mm01_00088824 predicted 1199
3 SASI_Mm01_00088825 predicted 246
4 SASI_Mm01_00088826 predicted 830
5 SASI_Mm01_00088827 predicted 1238
6 SASI_Mm01_00088828 predicted 1214
7 SASI_Mm01_00088829 predicted 598
8 SASI_Mm01_00088830 predicted 981
9 SASI_Mm01_00088832 predicted 803
10 SASI_Mm02_00288695 predicted 814
11 SASI_Mm01_00088831 predicted 951
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181539
KRT26 MISSION shRNA Bacterial Glycerol Stock
keratin 26
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181539.4-1239s21c1
Sequence:CCGGGCAAATCCACATGTTACAAATCTCGAGATTTGTAACATGTGGATTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181539.4-894s21c1
Sequence:CCGGCAACGCTGCAACAACAGATTTCTCGAGAAATCTGTTGTTGCAGCGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181539.4-460s21c1
Sequence:CCGGCTCAGTCATAGAAGATCTTAACTCGAGTTAAGATCTTCTATGACTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181539.4-1424s21c1
Sequence:CCGGGAGCAACGAGTACCTTCTAAACTCGAGTTTAGAAGGTACTCGTTGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181539.4-816s21c1
Sequence:CCGGACAACATGAGGGCTGAGTATGCTCGAGCATACTCAGCCCTCATGTTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181539.3-1334s1c1
Sequence:CCGGGTTGAGGAACTGGATCAAATTCTCGAGAATTTGATCCAGTTCCTCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181539.3-692s1c1
Sequence:CCGGGAGGAATTGACCTACCTCAAACTCGAGTTTGAGGTAGGTCAATTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181539.3-484s1c1
Sequence:CCGGGCAGATTACTTCTGCGACCATCTCGAGATGGTCGCAGAAGTAATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116612    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181539.3-1534s1c1
Sequence:CCGGCCTACTGGTCAAATAACCTAACTCGAGTTAGGTTATTTGACCAGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181539
KRT26 MISSION shRNA shRNA Plasmid DNA
keratin 26
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181539.4-1239s21c1
Sequence:CCGGGCAAATCCACATGTTACAAATCTCGAGATTTGTAACATGTGGATTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181539.4-894s21c1
Sequence:CCGGCAACGCTGCAACAACAGATTTCTCGAGAAATCTGTTGTTGCAGCGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181539.4-460s21c1
Sequence:CCGGCTCAGTCATAGAAGATCTTAACTCGAGTTAAGATCTTCTATGACTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181539.4-1424s21c1
Sequence:CCGGGAGCAACGAGTACCTTCTAAACTCGAGTTTAGAAGGTACTCGTTGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181539.4-816s21c1
Sequence:CCGGACAACATGAGGGCTGAGTATGCTCGAGCATACTCAGCCCTCATGTTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181539.3-1334s1c1
Sequence:CCGGGTTGAGGAACTGGATCAAATTCTCGAGAATTTGATCCAGTTCCTCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181539.3-692s1c1
Sequence:CCGGGAGGAATTGACCTACCTCAAACTCGAGTTTGAGGTAGGTCAATTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181539.3-484s1c1
Sequence:CCGGGCAGATTACTTCTGCGACCATCTCGAGATGGTCGCAGAAGTAATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116612    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181539.3-1534s1c1
Sequence:CCGGCCTACTGGTCAAATAACCTAACTCGAGTTAGGTTATTTGACCAGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181539
KRT26 MISSION shRNA Lentiviral Transduction Particles
keratin 26
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181539.4-1239s21c1
Sequence:CCGGGCAAATCCACATGTTACAAATCTCGAGATTTGTAACATGTGGATTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181539.4-894s21c1
Sequence:CCGGCAACGCTGCAACAACAGATTTCTCGAGAAATCTGTTGTTGCAGCGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181539.4-460s21c1
Sequence:CCGGCTCAGTCATAGAAGATCTTAACTCGAGTTAAGATCTTCTATGACTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181539.4-1424s21c1
Sequence:CCGGGAGCAACGAGTACCTTCTAAACTCGAGTTTAGAAGGTACTCGTTGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181539.4-816s21c1
Sequence:CCGGACAACATGAGGGCTGAGTATGCTCGAGCATACTCAGCCCTCATGTTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181539.3-1334s1c1
Sequence:CCGGGTTGAGGAACTGGATCAAATTCTCGAGAATTTGATCCAGTTCCTCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181539.3-692s1c1
Sequence:CCGGGAGGAATTGACCTACCTCAAACTCGAGTTTGAGGTAGGTCAATTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181539.3-484s1c1
Sequence:CCGGGCAGATTACTTCTGCGACCATCTCGAGATGGTCGCAGAAGTAATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116612    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181539.3-1534s1c1
Sequence:CCGGCCTACTGGTCAAATAACCTAACTCGAGTTAGGTTATTTGACCAGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_109734
KRT26 MISSION shRNA Bacterial Glycerol Stock
keratin 26
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091183    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_109734.3-1910s1c1
Sequence:CCGGGCAGCTTAGAAGAAGGTTTAACTCGAGTTAAACCTTCTTCTAAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_109734.3-1332s1c1
Sequence:CCGGGCTGAAGAGCTAGATCAACTTCTCGAGAAGTTGATCTAGCTCTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_109734.3-456s1c1
Sequence:CCGGAGCCGGTATTTCTCAGTCATTCTCGAGAATGACTGAGAAATACCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_109734.3-668s1c1
Sequence:CCGGCGACTTGGAAATACAACGGGACTCGAGTCCCGTTGTATTTCCAAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_109734.3-1017s1c1
Sequence:CCGGGCTATGAAACAATCCTACGAACTCGAGTTCGTAGGATTGTTTCATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_109734
KRT26 MISSION shRNA shRNA Plasmid DNA
keratin 26
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091183    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_109734.3-1910s1c1
Sequence:CCGGGCAGCTTAGAAGAAGGTTTAACTCGAGTTAAACCTTCTTCTAAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_109734.3-1332s1c1
Sequence:CCGGGCTGAAGAGCTAGATCAACTTCTCGAGAAGTTGATCTAGCTCTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_109734.3-456s1c1
Sequence:CCGGAGCCGGTATTTCTCAGTCATTCTCGAGAATGACTGAGAAATACCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_109734.3-668s1c1
Sequence:CCGGCGACTTGGAAATACAACGGGACTCGAGTCCCGTTGTATTTCCAAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_109734.3-1017s1c1
Sequence:CCGGGCTATGAAACAATCCTACGAACTCGAGTTCGTAGGATTGTTTCATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_109734
KRT26 MISSION shRNA Lentiviral Transduction Particles
keratin 26
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091183    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_109734.3-1910s1c1
Sequence:CCGGGCAGCTTAGAAGAAGGTTTAACTCGAGTTAAACCTTCTTCTAAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_109734.3-1332s1c1
Sequence:CCGGGCTGAAGAGCTAGATCAACTTCTCGAGAAGTTGATCTAGCTCTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_109734.3-456s1c1
Sequence:CCGGAGCCGGTATTTCTCAGTCATTCTCGAGAATGACTGAGAAATACCGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_109734.3-668s1c1
Sequence:CCGGCGACTTGGAAATACAACGGGACTCGAGTCCCGTTGTATTTCCAAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_109734.3-1017s1c1
Sequence:CCGGGCTATGAAACAATCCTACGAACTCGAGTTCGTAGGATTGTTTCATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)