EMAIL THIS PAGE TO A FRIEND

KRT27

keratin 27

52 Gene Product Result for
Synonyms: KRT25C
UniProtKB ID: Q7Z3Y8
Gene ID:
Human(342574) Summary: This gene encodes a member of the type I (acidic) keratin family, which belongs to the superfamily of intermediate filament (IF) proteins. Keratins are heteropolymeric structural proteins which form the intermediate filament. These filaments, along with actin microfilaments and microtubules, compose the cytoskeleton of epithelial cells. The type I keratin genes are clustered in a region of chromosome 17q12-q21. [provided by RefSeq, Jul 2009]
Mouse(16675) keratin 27
Rat(450229) keratin 27
cow(785245) keratin, type I cytoskeletal 27-like
cow(521074) keratin 27
dog(491007) keratin 27
Goat(100861382) keratin 27
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA055114 Anti-KRT27 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181537 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181537 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181537 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010666 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010666 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010666 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU147891 MISSION® esiRNA esiRNA targeting mouse Krt27 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181537 Rosetta Predictions human pricing
NM_001008824 Rosetta Predictions rat pricing
NM_010666 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181537 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00188242 predicted 606
2 SASI_Hs02_00370157 predicted 453
3 SASI_Hs02_00370158 predicted 466
4 SASI_Hs02_00370159 predicted 457
5 SASI_Hs01_00188246 predicted 1314
6 SASI_Hs02_00370160 predicted 938
7 SASI_Hs02_00370161 predicted 448
8 SASI_Hs01_00188247 predicted 482
9 SASI_Hs02_00370162 predicted 942
10 SASI_Hs01_00188248 predicted 499
11 SASI_Hs01_00188241 predicted 938
12 SASI_Hs01_00188243 predicted 455
13 SASI_Hs01_00188244 predicted 461
14 SASI_Hs01_00188245 predicted 465
15 SASI_Hs01_00188249 predicted 1226
16 SASI_Hs01_00188250 predicted 995
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008824 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00039593 predicted 867
2 SASI_Rn01_00039594 predicted 928
3 SASI_Rn02_00199316 predicted 869
4 SASI_Rn01_00039595 predicted 616
5 SASI_Rn01_00039597 predicted 862
6 SASI_Rn01_00039598 predicted 468
7 SASI_Rn01_00039599 predicted 431
8 SASI_Rn01_00039601 predicted 876
9 SASI_Rn01_00039602 predicted 832
10 SASI_Rn02_00199317 predicted 618
11 SASI_Rn01_00039596 predicted 895
12 SASI_Rn01_00039600 predicted 864
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010666 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00194619 predicted 880
2 SASI_Mm01_00194620 predicted 481
3 SASI_Mm01_00194621 predicted 450
4 SASI_Mm01_00194622 predicted 943
5 SASI_Mm01_00194623 predicted 542
6 SASI_Mm01_00194624 predicted 881
7 SASI_Mm01_00194625 predicted 1198
8 SASI_Mm01_00194626 predicted 1281
9 SASI_Mm02_00319090 predicted 1170
10 SASI_Mm02_00319091 predicted 1309
11 SASI_Mm01_00194627 predicted 232
12 SASI_Mm01_00194628 predicted 1103
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181537
KRT27 MISSION shRNA Bacterial Glycerol Stock
keratin 27
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181537.2-607s1c1
Sequence:CCGGCGGACATCAATGGTTTGCGAACTCGAGTTCGCAAACCATTGATGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181537.2-160s1c1
Sequence:CCGGGCATTGGAAGTGGCTTCTCTTCTCGAGAAGAGAAGCCACTTCCAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108395    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181537.2-1472s1c1
Sequence:CCGGGCTAGTTTCCTAAATAAGGGTCTCGAGACCCTTATTTAGGAAACTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181537.2-696s1c1
Sequence:CCGGCTCGCTTACCTCAAGAAGAATCTCGAGATTCTTCTTGAGGTAAGCGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181537.3-997s21c1
Sequence:CCGGAGTCCCTCTTAGCAACGAAACCTCGAGGTTTCGTTGCTAAGAGGGACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181537.2-1209s1c1
Sequence:CCGGCTCCTGATAGATGGAGAAGATCTCGAGATCTTCTCCATCTATCAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181537.3-800s21c1
Sequence:CCGGCACGGTTCTGCTGAACAATATCTCGAGATATTGTTCAGCAGAACCGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181537.3-489s21c1
Sequence:CCGGATTTCTGCAACTACCAGTAATCTCGAGATTACTGGTAGTTGCAGAAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181537.3-954s21c1
Sequence:CCGGATCGAGATGAAACGCACTCTTCTCGAGAAGAGTGCGTTTCATCTCGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181537.3-458s21c1
Sequence:CCGGCCCAATTATTGACGAACTTAACTCGAGTTAAGTTCGTCAATAATTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181537
KRT27 MISSION shRNA shRNA Plasmid DNA
keratin 27
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181537.2-607s1c1
Sequence:CCGGCGGACATCAATGGTTTGCGAACTCGAGTTCGCAAACCATTGATGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181537.2-160s1c1
Sequence:CCGGGCATTGGAAGTGGCTTCTCTTCTCGAGAAGAGAAGCCACTTCCAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108395    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181537.2-1472s1c1
Sequence:CCGGGCTAGTTTCCTAAATAAGGGTCTCGAGACCCTTATTTAGGAAACTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181537.2-696s1c1
Sequence:CCGGCTCGCTTACCTCAAGAAGAATCTCGAGATTCTTCTTGAGGTAAGCGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181537.3-997s21c1
Sequence:CCGGAGTCCCTCTTAGCAACGAAACCTCGAGGTTTCGTTGCTAAGAGGGACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181537.2-1209s1c1
Sequence:CCGGCTCCTGATAGATGGAGAAGATCTCGAGATCTTCTCCATCTATCAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181537.3-800s21c1
Sequence:CCGGCACGGTTCTGCTGAACAATATCTCGAGATATTGTTCAGCAGAACCGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181537.3-489s21c1
Sequence:CCGGATTTCTGCAACTACCAGTAATCTCGAGATTACTGGTAGTTGCAGAAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181537.3-954s21c1
Sequence:CCGGATCGAGATGAAACGCACTCTTCTCGAGAAGAGTGCGTTTCATCTCGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181537.3-458s21c1
Sequence:CCGGCCCAATTATTGACGAACTTAACTCGAGTTAAGTTCGTCAATAATTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181537
KRT27 MISSION shRNA Lentiviral Transduction Particles
keratin 27
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181537.2-607s1c1
Sequence:CCGGCGGACATCAATGGTTTGCGAACTCGAGTTCGCAAACCATTGATGTCCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000108399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181537.2-160s1c1
Sequence:CCGGGCATTGGAAGTGGCTTCTCTTCTCGAGAAGAGAAGCCACTTCCAATGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000108395    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181537.2-1472s1c1
Sequence:CCGGGCTAGTTTCCTAAATAAGGGTCTCGAGACCCTTATTTAGGAAACTAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000108398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181537.2-696s1c1
Sequence:CCGGCTCGCTTACCTCAAGAAGAATCTCGAGATTCTTCTTGAGGTAAGCGAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000429981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181537.3-997s21c1
Sequence:CCGGAGTCCCTCTTAGCAACGAAACCTCGAGGTTTCGTTGCTAAGAGGGACTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000108397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181537.2-1209s1c1
Sequence:CCGGCTCCTGATAGATGGAGAAGATCTCGAGATCTTCTCCATCTATCAGGAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000435878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181537.3-800s21c1
Sequence:CCGGCACGGTTCTGCTGAACAATATCTCGAGATATTGTTCAGCAGAACCGTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000431330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181537.3-489s21c1
Sequence:CCGGATTTCTGCAACTACCAGTAATCTCGAGATTACTGGTAGTTGCAGAAATTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000427651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181537.3-954s21c1
Sequence:CCGGATCGAGATGAAACGCACTCTTCTCGAGAAGAGTGCGTTTCATCTCGATTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000428359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181537.3-458s21c1
Sequence:CCGGCCCAATTATTGACGAACTTAACTCGAGTTAAGTTCGTCAATAATTGGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010666
KRT27 MISSION shRNA Bacterial Glycerol Stock
keratin 27
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090973    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010666.1-1388s1c1
Sequence:CCGGCGGCTCTAGTTTCAAATACCACTCGAGTGGTATTTGAAACTAGAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010666.1-410s1c1
Sequence:CCGGCCATCATTGATGACCTCAGGACTCGAGTCCTGAGGTCATCAATGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010666.1-1323s1c1
Sequence:CCGGGAAATCCACCAAAGTCAACAACTCGAGTTGTTGACTTTGGTGGATTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010666.1-894s1c1
Sequence:CCGGGAACGAACTTACAGAGATGAACTCGAGTTCATCTCTGTAAGTTCGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010666.1-936s1c1
Sequence:CCGGGATAGAGCTACAGTCCCTCTTCTCGAGAAGAGGGACTGTAGCTCTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010666
KRT27 MISSION shRNA shRNA Plasmid DNA
keratin 27
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090973    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010666.1-1388s1c1
Sequence:CCGGCGGCTCTAGTTTCAAATACCACTCGAGTGGTATTTGAAACTAGAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010666.1-410s1c1
Sequence:CCGGCCATCATTGATGACCTCAGGACTCGAGTCCTGAGGTCATCAATGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010666.1-1323s1c1
Sequence:CCGGGAAATCCACCAAAGTCAACAACTCGAGTTGTTGACTTTGGTGGATTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010666.1-894s1c1
Sequence:CCGGGAACGAACTTACAGAGATGAACTCGAGTTCATCTCTGTAAGTTCGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010666.1-936s1c1
Sequence:CCGGGATAGAGCTACAGTCCCTCTTCTCGAGAAGAGGGACTGTAGCTCTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010666
KRT27 MISSION shRNA Lentiviral Transduction Particles
keratin 27
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090973    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010666.1-1388s1c1
Sequence:CCGGCGGCTCTAGTTTCAAATACCACTCGAGTGGTATTTGAAACTAGAGCCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000090975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010666.1-410s1c1
Sequence:CCGGCCATCATTGATGACCTCAGGACTCGAGTCCTGAGGTCATCAATGATGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000090976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010666.1-1323s1c1
Sequence:CCGGGAAATCCACCAAAGTCAACAACTCGAGTTGTTGACTTTGGTGGATTTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000090974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010666.1-894s1c1
Sequence:CCGGGAACGAACTTACAGAGATGAACTCGAGTTCATCTCTGTAAGTTCGTTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000090977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010666.1-936s1c1
Sequence:CCGGGATAGAGCTACAGTCCCTCTTCTCGAGAAGAGGGACTGTAGCTCTATCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???