EMAIL THIS PAGE TO A FRIEND

KRT28

keratin 28

73 Gene Product Result for
Synonyms: KRT25D
UniProtKB ID: Q7Z3Y7, Q6ZP84
Gene ID:
Human(162605) Summary: This gene encodes a member of the type I (acidic) keratin family, which belongs to the superfamily of intermediate filament (IF) proteins. Keratins are heteropolymeric structural proteins which form the intermediate filament. These filaments, along with actin microfilaments and microtubules, compose the cytoskeleton of epithelial cells. The type I keratin genes are clustered in a region of chromosome 17q12-q21. [provided by RefSeq, Jul 2009]
Mouse(70843) keratin 28
Rat(360623) keratin 28
cow(788909) keratin 28
Horse(100067557) keratin 28
dog(608107) keratin 28
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181535 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181535 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181535 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_203344 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_203344 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_203344 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU145251 MISSION® esiRNA esiRNA human KRT28 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181535 Rosetta Predictions human pricing
NM_001008760 Rosetta Predictions rat pricing
XM_579208 Rosetta Predictions rat pricing
XM_203344 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181535 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00205924 predicted 488
2 SASI_Hs02_00370154 predicted 487
3 SASI_Hs01_00205927 predicted 474
4 SASI_Hs01_00205928 predicted 1181
5 SASI_Hs01_00205929 predicted 524
6 SASI_Hs02_00370155 predicted 492
7 SASI_Hs01_00205931 predicted 1303
8 SASI_Hs01_00205932 predicted 693
9 SASI_Hs02_00370156 predicted 478
10 SASI_Hs01_00205933 predicted 1330
11 SASI_Hs01_00205925 predicted 1329
12 SASI_Hs01_00205926 predicted 1319
13 SASI_Hs01_00205930 predicted 470
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008760 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00111589 predicted 612
2 SASI_Rn01_00111590 predicted 503
3 SASI_Rn01_00111591 predicted 460
4 SASI_Rn01_00111592 predicted 388
5 SASI_Rn01_00111593 predicted 227
6 SASI_Rn01_00111594 predicted 495
7 SASI_Rn01_00111595 predicted 324
8 SASI_Rn01_00111596 predicted 469
9 SASI_Rn02_00199260 predicted 501
10 SASI_Rn01_00111598 predicted 404
11 SASI_Rn01_00111597 predicted 859
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579208 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00144326 predicted 622
2 SASI_Rn01_00144327 predicted 510
3 SASI_Rn01_00144328 predicted 459
4 SASI_Rn01_00144329 predicted 393
5 SASI_Rn01_00144330 predicted 239
6 SASI_Rn01_00144331 predicted 496
7 SASI_Rn01_00144332 predicted 335
8 SASI_Rn01_00144333 predicted 467
9 SASI_Rn01_00144334 predicted 864
10 SASI_Rn01_00144335 predicted 409
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_203344 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00425511 predicted 378
2 SASI_Mm02_00425512 predicted 244
3 SASI_Mm02_00425513 predicted 325
4 SASI_Mm02_00425514 predicted 326
5 SASI_Mm02_00425515 predicted 286
6 SASI_Mm02_00425516 predicted 315
7 SASI_Mm02_00425517 predicted 241
8 SASI_Mm02_00425518 predicted 328
9 SASI_Mm02_00425519 predicted 225
10 SASI_Mm02_00425520 predicted 239
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181535
KRT28 MISSION shRNA Bacterial Glycerol Stock
keratin 28
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181535.3-1357s21c1
Sequence:CCGGGAGCTAGATCAACGTGGTAAACTCGAGTTTACCACGTTGATCTAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181535.3-1450s21c1
Sequence:CCGGGTTCCTTTCTAGCTGTCATTTCTCGAGAAATGACAGCTAGAAAGGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181535.3-1428s21c1
Sequence:CCGGCAACGGCAAGACAGAACAAAGCTCGAGCTTTGTTCTGTCTTGCCGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181535.3-527s21c1
Sequence:CCGGCCACTACTACTAATGCTAATGCTCGAGCATTAGCATTAGTAGTAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116267    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181535.2-1499s1c1
Sequence:CCGGCAGAGAGAATATACACACTTTCTCGAGAAAGTGTGTATATTCTCTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181535.2-1244s1c1
Sequence:CCGGCCAAATCAAAGGGCTTTGGATCTCGAGATCCAAAGCCCTTTGATTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181535.2-361s1c1
Sequence:CCGGGAGGAGGCAAATGCTGAATTACTCGAGTAATTCAGCATTTGCCTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181535.2-234s1c1
Sequence:CCGGCCTTGGAAATGCTGCTTGTATCTCGAGATACAAGCAGCATTTCCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181535.2-1214s1c1
Sequence:CCGGGCCTGATAGATGGAGATGGAACTCGAGTTCCATCTCCATCTATCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181535
KRT28 MISSION shRNA shRNA Plasmid DNA
keratin 28
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181535.3-1357s21c1
Sequence:CCGGGAGCTAGATCAACGTGGTAAACTCGAGTTTACCACGTTGATCTAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181535.3-1450s21c1
Sequence:CCGGGTTCCTTTCTAGCTGTCATTTCTCGAGAAATGACAGCTAGAAAGGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181535.3-1428s21c1
Sequence:CCGGCAACGGCAAGACAGAACAAAGCTCGAGCTTTGTTCTGTCTTGCCGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181535.3-527s21c1
Sequence:CCGGCCACTACTACTAATGCTAATGCTCGAGCATTAGCATTAGTAGTAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116267    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181535.2-1499s1c1
Sequence:CCGGCAGAGAGAATATACACACTTTCTCGAGAAAGTGTGTATATTCTCTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181535.2-1244s1c1
Sequence:CCGGCCAAATCAAAGGGCTTTGGATCTCGAGATCCAAAGCCCTTTGATTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181535.2-361s1c1
Sequence:CCGGGAGGAGGCAAATGCTGAATTACTCGAGTAATTCAGCATTTGCCTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181535.2-234s1c1
Sequence:CCGGCCTTGGAAATGCTGCTTGTATCTCGAGATACAAGCAGCATTTCCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181535.2-1214s1c1
Sequence:CCGGGCCTGATAGATGGAGATGGAACTCGAGTTCCATCTCCATCTATCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181535
KRT28 MISSION shRNA Lentiviral Transduction Particles
keratin 28
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181535.3-1357s21c1
Sequence:CCGGGAGCTAGATCAACGTGGTAAACTCGAGTTTACCACGTTGATCTAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181535.3-1450s21c1
Sequence:CCGGGTTCCTTTCTAGCTGTCATTTCTCGAGAAATGACAGCTAGAAAGGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181535.3-1428s21c1
Sequence:CCGGCAACGGCAAGACAGAACAAAGCTCGAGCTTTGTTCTGTCTTGCCGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181535.3-527s21c1
Sequence:CCGGCCACTACTACTAATGCTAATGCTCGAGCATTAGCATTAGTAGTAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116267    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181535.2-1499s1c1
Sequence:CCGGCAGAGAGAATATACACACTTTCTCGAGAAAGTGTGTATATTCTCTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181535.2-1244s1c1
Sequence:CCGGCCAAATCAAAGGGCTTTGGATCTCGAGATCCAAAGCCCTTTGATTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181535.2-361s1c1
Sequence:CCGGGAGGAGGCAAATGCTGAATTACTCGAGTAATTCAGCATTTGCCTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181535.2-234s1c1
Sequence:CCGGCCTTGGAAATGCTGCTTGTATCTCGAGATACAAGCAGCATTTCCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181535.2-1214s1c1
Sequence:CCGGGCCTGATAGATGGAGATGGAACTCGAGTTCCATCTCCATCTATCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_203344
KRT28 MISSION shRNA Bacterial Glycerol Stock
keratin 28
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091543    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_203344.2-1547s1c1
Sequence:CCGGGCTAGGGGGATAGAGTAACTTCTCGAGAAGTTACTCTATCCCCCTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_203344.2-414s1c1
Sequence:CCGGGCAGAATCTTAACAACCGCTTCTCGAGAAGCGGTTGTTAAGATTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_203344.2-88s1c1
Sequence:CCGGAGGTTCTGTACGCCTTTGAAACTCGAGTTTCAAAGGCGTACAGAACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_203344.2-657s1c1
Sequence:CCGGCGCAGACGATTTCCGACTAAACTCGAGTTTAGTCGGAAATCGTCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_203344.2-608s1c1
Sequence:CCGGCGGCTGCTAATGCTAATATAACTCGAGTTATATTAGCATTAGCAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_203344
KRT28 MISSION shRNA shRNA Plasmid DNA
keratin 28
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091543    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_203344.2-1547s1c1
Sequence:CCGGGCTAGGGGGATAGAGTAACTTCTCGAGAAGTTACTCTATCCCCCTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_203344.2-414s1c1
Sequence:CCGGGCAGAATCTTAACAACCGCTTCTCGAGAAGCGGTTGTTAAGATTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_203344.2-88s1c1
Sequence:CCGGAGGTTCTGTACGCCTTTGAAACTCGAGTTTCAAAGGCGTACAGAACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_203344.2-657s1c1
Sequence:CCGGCGCAGACGATTTCCGACTAAACTCGAGTTTAGTCGGAAATCGTCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_203344.2-608s1c1
Sequence:CCGGCGGCTGCTAATGCTAATATAACTCGAGTTATATTAGCATTAGCAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_203344
KRT28 MISSION shRNA Lentiviral Transduction Particles
keratin 28
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091543    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_203344.2-1547s1c1
Sequence:CCGGGCTAGGGGGATAGAGTAACTTCTCGAGAAGTTACTCTATCCCCCTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_203344.2-414s1c1
Sequence:CCGGGCAGAATCTTAACAACCGCTTCTCGAGAAGCGGTTGTTAAGATTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_203344.2-88s1c1
Sequence:CCGGAGGTTCTGTACGCCTTTGAAACTCGAGTTTCAAAGGCGTACAGAACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_203344.2-657s1c1
Sequence:CCGGCGCAGACGATTTCCGACTAAACTCGAGTTTAGTCGGAAATCGTCTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_203344.2-608s1c1
Sequence:CCGGCGGCTGCTAATGCTAATATAACTCGAGTTATATTAGCATTAGCAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)