EMAIL THIS PAGE TO A FRIEND

KRT2

keratin 2

49 Gene Product Result for
Synonyms: CK-2e K2e KRT2A KRT2E KRTE
UniProtKB ID: P35908, Q4VAQ2
Gene ID:
Human(3849) Summary: The protein encoded by this gene is a member of the keratin gene family. The type II cytokeratins consist of basic or neutral proteins which are arranged in pairs of heterotypic keratin chains coexpressed during differentiation of simple and stratified epithelial tissues. This type II cytokeratin is expressed largely in the upper spinous layer of epidermal keratinocytes and mutations in this gene have been associated with bullous congenital ichthyosiform erythroderma. The type II cytokeratins are clustered in a region of chromosome 12q12-q13. [provided by RefSeq, Jul 2008]
Mouse(16681) keratin 2
Rat(406228) keratin 2
dog(444850) keratin 2
cow(786381) keratin 2
sheep(101109688) keratin 2
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000423 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000423 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000423 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010668 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010668 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010668 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000423 Rosetta Predictions human pricing
NM_001008899 Rosetta Predictions rat pricing
NM_010668 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000423 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00100641 predicted 891
2 SASI_Hs02_00302524 predicted 761
3 SASI_Hs01_00100642 predicted 773
4 SASI_Hs01_00100643 predicted 898
5 SASI_Hs01_00100644 predicted 1530
6 SASI_Hs01_00100645 predicted 2021
7 SASI_Hs01_00100646 predicted 1883
8 SASI_Hs01_00100647 predicted 2024
9 SASI_Hs01_00100649 predicted 1194
10 SASI_Hs01_00100650 predicted 1341
11 SASI_Hs01_00100648 predicted 962
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008899 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00087082 predicted 555
2 SASI_Rn01_00087083 predicted 784
3 SASI_Rn01_00087084 predicted 499
4 SASI_Rn01_00087085 predicted 799
5 SASI_Rn01_00087086 predicted 1046
6 SASI_Rn01_00087088 predicted 748
7 SASI_Rn01_00087089 predicted 512
8 SASI_Rn01_00087090 predicted 1289
9 SASI_Rn02_00199450 predicted 1124
10 SASI_Rn02_00199451 predicted 563
11 SASI_Rn01_00087081 predicted 1032
12 SASI_Rn01_00087087 predicted 1032
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010668 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00061915 predicted 236
2 SASI_Mm02_00319095 predicted 1285
3 SASI_Mm01_00061916 predicted 1204
4 SASI_Mm01_00061917 predicted 484
5 SASI_Mm01_00061918 predicted 816
6 SASI_Mm02_00319096 predicted 2231
7 SASI_Mm01_00061921 predicted 1191
8 SASI_Mm01_00061919 predicted 1116
9 SASI_Mm01_00061922 predicted 579
10 SASI_Mm02_00319097 predicted 285
11 SASI_Mm01_00061920 predicted 655
12 SASI_Mm01_00061923 predicted 2237
13 SASI_Mm01_00061924 predicted 1027
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000423
KRT2 MISSION shRNA Bacterial Glycerol Stock
keratin 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000419708    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000423.2-2120s21c1
Sequence:CCGGCTCTCCAAACCAGTTAGTTAGCTCGAGCTAACTAACTGGTTTGGAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000423.2-806s21c1
Sequence:CCGGAGGATCTTGTGGAGGATTATACTCGAGTATAATCCTCCACAAGATCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108430    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000423.2-2226s1c1
Sequence:CCGGGCCTCTTTGCATTGCCCATTTCTCGAGAAATGGGCAATGCAAAGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000423.2-1279s1c1
Sequence:CCGGCAGTGTAAGAATGTGCAAGATCTCGAGATCTTGCACATTCTTACACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000423.2-898s1c1
Sequence:CCGGGTGGACAATGCCTACATGATACTCGAGTATCATGTAGGCATTGTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000423.2-976s1c1
Sequence:CCGGGTTCTCTATGATGCGGAGATACTCGAGTATCTCCGCATCATAGAGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000423.2-1553s1c1
Sequence:CCGGCCATTTCATCAAATGTGGCATCTCGAGATGCCACATTTGATGAAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000423
KRT2 MISSION shRNA shRNA Plasmid DNA
keratin 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000419708    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000423.2-2120s21c1
Sequence:CCGGCTCTCCAAACCAGTTAGTTAGCTCGAGCTAACTAACTGGTTTGGAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000423.2-806s21c1
Sequence:CCGGAGGATCTTGTGGAGGATTATACTCGAGTATAATCCTCCACAAGATCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108430    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000423.2-2226s1c1
Sequence:CCGGGCCTCTTTGCATTGCCCATTTCTCGAGAAATGGGCAATGCAAAGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000423.2-1279s1c1
Sequence:CCGGCAGTGTAAGAATGTGCAAGATCTCGAGATCTTGCACATTCTTACACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000423.2-898s1c1
Sequence:CCGGGTGGACAATGCCTACATGATACTCGAGTATCATGTAGGCATTGTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000423.2-976s1c1
Sequence:CCGGGTTCTCTATGATGCGGAGATACTCGAGTATCTCCGCATCATAGAGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000423.2-1553s1c1
Sequence:CCGGCCATTTCATCAAATGTGGCATCTCGAGATGCCACATTTGATGAAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000423
KRT2 MISSION shRNA Lentiviral Transduction Particles
keratin 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000419708    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000423.2-2120s21c1
Sequence:CCGGCTCTCCAAACCAGTTAGTTAGCTCGAGCTAACTAACTGGTTTGGAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000423.2-806s21c1
Sequence:CCGGAGGATCTTGTGGAGGATTATACTCGAGTATAATCCTCCACAAGATCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108430    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000423.2-2226s1c1
Sequence:CCGGGCCTCTTTGCATTGCCCATTTCTCGAGAAATGGGCAATGCAAAGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000423.2-1279s1c1
Sequence:CCGGCAGTGTAAGAATGTGCAAGATCTCGAGATCTTGCACATTCTTACACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000423.2-898s1c1
Sequence:CCGGGTGGACAATGCCTACATGATACTCGAGTATCATGTAGGCATTGTCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000423.2-976s1c1
Sequence:CCGGGTTCTCTATGATGCGGAGATACTCGAGTATCTCCGCATCATAGAGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000423.2-1553s1c1
Sequence:CCGGCCATTTCATCAAATGTGGCATCTCGAGATGCCACATTTGATGAAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010668
KRT2 MISSION shRNA Bacterial Glycerol Stock
keratin 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089608    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010668.1-2200s1c1
Sequence:CCGGGCTGTTATCTCTGTATCTCTACTCGAGTAGAGATACAGAGATAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010668.1-1153s1c1
Sequence:CCGGTCAGAATCAATACGAGATGATCTCGAGATCATCTCGTATTGATTCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010668.1-578s1c1
Sequence:CCGGCAGCCTCTTGATGTTAAAGTACTCGAGTACTTTAACATCAAGAGGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010668.1-1331s1c1
Sequence:CCGGCATGTGAAGAAGCAGTGTATACTCGAGTATACACTGCTTCTTCACATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010668.1-1004s1c1
Sequence:CCGGCTGGACATACTAGCACAGGAACTCGAGTTCCTGTGCTAGTATGTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010668
KRT2 MISSION shRNA shRNA Plasmid DNA
keratin 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089608    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010668.1-2200s1c1
Sequence:CCGGGCTGTTATCTCTGTATCTCTACTCGAGTAGAGATACAGAGATAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010668.1-1153s1c1
Sequence:CCGGTCAGAATCAATACGAGATGATCTCGAGATCATCTCGTATTGATTCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010668.1-578s1c1
Sequence:CCGGCAGCCTCTTGATGTTAAAGTACTCGAGTACTTTAACATCAAGAGGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010668.1-1331s1c1
Sequence:CCGGCATGTGAAGAAGCAGTGTATACTCGAGTATACACTGCTTCTTCACATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010668.1-1004s1c1
Sequence:CCGGCTGGACATACTAGCACAGGAACTCGAGTTCCTGTGCTAGTATGTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010668
KRT2 MISSION shRNA Lentiviral Transduction Particles
keratin 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089608    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010668.1-2200s1c1
Sequence:CCGGGCTGTTATCTCTGTATCTCTACTCGAGTAGAGATACAGAGATAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010668.1-1153s1c1
Sequence:CCGGTCAGAATCAATACGAGATGATCTCGAGATCATCTCGTATTGATTCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010668.1-578s1c1
Sequence:CCGGCAGCCTCTTGATGTTAAAGTACTCGAGTACTTTAACATCAAGAGGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010668.1-1331s1c1
Sequence:CCGGCATGTGAAGAAGCAGTGTATACTCGAGTATACACTGCTTCTTCACATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010668.1-1004s1c1
Sequence:CCGGCTGGACATACTAGCACAGGAACTCGAGTTCCTGTGCTAGTATGTCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)