EMAIL THIS PAGE TO A FRIEND

KRT31

keratin 31

58 Gene Product Result for
Synonyms: HA1 Ha-1 KRTHA1 hHa1
UniProtKB ID: Q15323, Q9UE12
Gene ID:
Human(3881) Summary: The protein encoded by this gene is a member of the keratin gene family. As a type I hair keratin, it is an acidic protein which heterodimerizes with type II keratins to form hair and nails. The type I hair keratins are clustered in a region of chromosome 17q12-q21 and have the same direction of transcription. [provided by RefSeq, Jul 2008]
Mouse(16660) keratin 31
Rat(450228) keratin 31
cow(539597) keratin 31
cow(618453) keratin 31
dog(490988) keratin 31
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002277 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002277 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002277 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010659 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010659 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010659 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002277 Rosetta Predictions human pricing
NM_001008817 Rosetta Predictions rat pricing
NM_010659 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002277 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00139673 predicted 1304
2 SASI_Hs01_00139674 predicted 1196
3 SASI_Hs01_00139676 predicted 1135
4 SASI_Hs01_00139675 predicted 608
5 SASI_Hs01_00139677 predicted 1417
6 SASI_Hs01_00139678 predicted 1429
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008817 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00041587 predicted 351
2 SASI_Rn01_00041588 predicted 1133
3 SASI_Rn01_00041589 predicted 1083
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010659 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00191934 predicted 411
2 SASI_Mm01_00191935 predicted 476
3 SASI_Mm01_00191937 predicted 1205
4 SASI_Mm02_00319059 predicted 1423
5 SASI_Mm02_00319060 predicted 1452
6 SASI_Mm02_00319061 predicted 1373
7 SASI_Mm02_00319062 predicted 1519
8 SASI_Mm02_00319063 predicted 1421
9 SASI_Mm02_00319064 predicted 1481
10 SASI_Mm01_00191932 predicted 806
11 SASI_Mm01_00191933 predicted 448
12 SASI_Mm01_00191936 predicted 967
13 SASI_Mm01_00191938 predicted 267
14 SASI_Mm01_00191939 predicted 796
15 SASI_Mm01_00191940 predicted 1164
16 SASI_Mm01_00191941 predicted 976
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002277
KRT31 MISSION shRNA Bacterial Glycerol Stock
keratin 31
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432842    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002277.2-1356s21c1
Sequence:CCGGTGTGACCTGGCTCTGGTTCAACTCGAGTTGAACCAGAGCCAGGTCACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002277.2-404s1c1
Sequence:CCGGCCTGTGTACCAAGTCTGAGAACTCGAGTTCTCAGACTTGGTACACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002277.2-1143s1c1
Sequence:CCGGGACTGCAATCTGCCCAGCAATCTCGAGATTGCTGGGCAGATTGCAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116792    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002277.2-1428s1c1
Sequence:CCGGCAGCCAAGAAACTCACCCAAACTCGAGTTTGGGTGAGTTTCTTGGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002277.2-465s21c1
Sequence:CCGGGCGGATGATTTCAGAACCAAGCTCGAGCTTGGTTCTGAAATCATCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002277.2-709s1c1
Sequence:CCGGTGGACCTGAATCGGGTGCTGACTCGAGTCAGCACCCGATTCAGGTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002277.2-1283s1c1
Sequence:CCGGCTGCAATTCCTTCGTGCGCTACTCGAGTAGCGCACGAAGGAATTGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002277
KRT31 MISSION shRNA shRNA Plasmid DNA
keratin 31
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432842    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002277.2-1356s21c1
Sequence:CCGGTGTGACCTGGCTCTGGTTCAACTCGAGTTGAACCAGAGCCAGGTCACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002277.2-404s1c1
Sequence:CCGGCCTGTGTACCAAGTCTGAGAACTCGAGTTCTCAGACTTGGTACACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002277.2-1143s1c1
Sequence:CCGGGACTGCAATCTGCCCAGCAATCTCGAGATTGCTGGGCAGATTGCAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116792    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002277.2-1428s1c1
Sequence:CCGGCAGCCAAGAAACTCACCCAAACTCGAGTTTGGGTGAGTTTCTTGGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002277.2-465s21c1
Sequence:CCGGGCGGATGATTTCAGAACCAAGCTCGAGCTTGGTTCTGAAATCATCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002277.2-709s1c1
Sequence:CCGGTGGACCTGAATCGGGTGCTGACTCGAGTCAGCACCCGATTCAGGTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002277.2-1283s1c1
Sequence:CCGGCTGCAATTCCTTCGTGCGCTACTCGAGTAGCGCACGAAGGAATTGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002277
KRT31 MISSION shRNA Lentiviral Transduction Particles
keratin 31
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432842    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002277.2-1356s21c1
Sequence:CCGGTGTGACCTGGCTCTGGTTCAACTCGAGTTGAACCAGAGCCAGGTCACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002277.2-404s1c1
Sequence:CCGGCCTGTGTACCAAGTCTGAGAACTCGAGTTCTCAGACTTGGTACACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002277.2-1143s1c1
Sequence:CCGGGACTGCAATCTGCCCAGCAATCTCGAGATTGCTGGGCAGATTGCAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116792    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002277.2-1428s1c1
Sequence:CCGGCAGCCAAGAAACTCACCCAAACTCGAGTTTGGGTGAGTTTCTTGGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002277.2-465s21c1
Sequence:CCGGGCGGATGATTTCAGAACCAAGCTCGAGCTTGGTTCTGAAATCATCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002277.2-709s1c1
Sequence:CCGGTGGACCTGAATCGGGTGCTGACTCGAGTCAGCACCCGATTCAGGTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002277.2-1283s1c1
Sequence:CCGGCTGCAATTCCTTCGTGCGCTACTCGAGTAGCGCACGAAGGAATTGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010659
KRT31 MISSION shRNA Bacterial Glycerol Stock
keratin 31
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000415326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010659.2-502s21c1
Sequence:CCGGTATGAGACAGAGCTCGGTCTGCTCGAGCAGACCGAGCTCTGTCTCATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010659.2-1189s21c1
Sequence:CCGGACAAGCAATGCATGCGGCAAGCTCGAGCTTGCCGCATGCATTGCTTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010659.1-528s1c1
Sequence:CCGGCGTGGTAGAGTCAGACATCAACTCGAGTTGATGTCTGACTCTACCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010659.1-425s1c1
Sequence:CCGGGCAGCAAATCAGAGAATGCGACTCGAGTCGCATTCTCTGATTTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010659.1-445s1c1
Sequence:CCGGAGGTTGGTGGTGCAGATAGATCTCGAGATCTATCTGCACCACCAACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010659.1-412s1c1
Sequence:CCGGCAGAAGATCCTGTGCAGCAAACTCGAGTTTGCTGCACAGGATCTTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089568    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010659.1-1376s1c1
Sequence:CCGGACCTGGTTCTGGTTCCACAAACTCGAGTTTGTGGAACCAGAACCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010659.2-555s21c1
Sequence:CCGGGCGAAGGATCTTGGATGAGCTCTCGAGAGCTCATCCAAGATCCTTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434064    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010659.2-1350s21c1
Sequence:CCGGACTGGGCTTAGCACTCCAGATCTCGAGATCTGGAGTGCTAAGCCCAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010659.2-1302s21c1
Sequence:CCGGCAACTCCTTTGTACGCTAGAACTCGAGTTCTAGCGTACAAAGGAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010659
KRT31 MISSION shRNA shRNA Plasmid DNA
keratin 31
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000415326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010659.2-502s21c1
Sequence:CCGGTATGAGACAGAGCTCGGTCTGCTCGAGCAGACCGAGCTCTGTCTCATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010659.2-1189s21c1
Sequence:CCGGACAAGCAATGCATGCGGCAAGCTCGAGCTTGCCGCATGCATTGCTTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010659.1-528s1c1
Sequence:CCGGCGTGGTAGAGTCAGACATCAACTCGAGTTGATGTCTGACTCTACCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010659.1-425s1c1
Sequence:CCGGGCAGCAAATCAGAGAATGCGACTCGAGTCGCATTCTCTGATTTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010659.1-445s1c1
Sequence:CCGGAGGTTGGTGGTGCAGATAGATCTCGAGATCTATCTGCACCACCAACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010659.1-412s1c1
Sequence:CCGGCAGAAGATCCTGTGCAGCAAACTCGAGTTTGCTGCACAGGATCTTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089568    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010659.1-1376s1c1
Sequence:CCGGACCTGGTTCTGGTTCCACAAACTCGAGTTTGTGGAACCAGAACCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010659.2-555s21c1
Sequence:CCGGGCGAAGGATCTTGGATGAGCTCTCGAGAGCTCATCCAAGATCCTTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434064    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010659.2-1350s21c1
Sequence:CCGGACTGGGCTTAGCACTCCAGATCTCGAGATCTGGAGTGCTAAGCCCAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010659.2-1302s21c1
Sequence:CCGGCAACTCCTTTGTACGCTAGAACTCGAGTTCTAGCGTACAAAGGAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010659
KRT31 MISSION shRNA Lentiviral Transduction Particles
keratin 31
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000415326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010659.2-502s21c1
Sequence:CCGGTATGAGACAGAGCTCGGTCTGCTCGAGCAGACCGAGCTCTGTCTCATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010659.2-1189s21c1
Sequence:CCGGACAAGCAATGCATGCGGCAAGCTCGAGCTTGCCGCATGCATTGCTTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010659.1-528s1c1
Sequence:CCGGCGTGGTAGAGTCAGACATCAACTCGAGTTGATGTCTGACTCTACCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010659.1-425s1c1
Sequence:CCGGGCAGCAAATCAGAGAATGCGACTCGAGTCGCATTCTCTGATTTGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010659.1-445s1c1
Sequence:CCGGAGGTTGGTGGTGCAGATAGATCTCGAGATCTATCTGCACCACCAACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010659.1-412s1c1
Sequence:CCGGCAGAAGATCCTGTGCAGCAAACTCGAGTTTGCTGCACAGGATCTTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089568    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010659.1-1376s1c1
Sequence:CCGGACCTGGTTCTGGTTCCACAAACTCGAGTTTGTGGAACCAGAACCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010659.2-555s21c1
Sequence:CCGGGCGAAGGATCTTGGATGAGCTCTCGAGAGCTCATCCAAGATCCTTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434064    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010659.2-1350s21c1
Sequence:CCGGACTGGGCTTAGCACTCCAGATCTCGAGATCTGGAGTGCTAAGCCCAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010659.2-1302s21c1
Sequence:CCGGCAACTCCTTTGTACGCTAGAACTCGAGTTCTAGCGTACAAAGGAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)